\
| Variant ID: vg0106807221 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 6807221 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, T: 0.04, others allele: 0.00, population size: 113. )
GATAGTATAAACGTAGTACTCCCTCCGTCAAAAAAAAAACAACTATACAAGAATACTCCCTCCGTCCAAAAAAAGACAAACCCTAGGTTTCCATGCTCAA[C/T]
GTTTGACTGTTCGTCTTATATGAAATTTTTTTATAATTAGTATTTTTATTGTTGTTAGATGATAAAACATGATTAATATTTTATGTGTGACTTATCTTTT
AAAAGATAAGTCACACATAAAATATTAATCATGTTTTATCATCTAACAACAATAAAAATACTAATTATAAAAAAATTTCATATAAGACGAACAGTCAAAC[G/A]
TTGAGCATGGAAACCTAGGGTTTGTCTTTTTTTGGACGGAGGGAGTATTCTTGTATAGTTGTTTTTTTTTTGACGGAGGGAGTACTACGTTTATACTATC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 74.40% | 22.50% | 1.95% | 1.10% | NA |
| All Indica | 2759 | 71.20% | 28.10% | 0.62% | 0.07% | NA |
| All Japonica | 1512 | 74.70% | 17.30% | 4.83% | 3.17% | NA |
| Aus | 269 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 87.20% | 12.80% | 0.00% | 0.00% | NA |
| Indica II | 465 | 54.00% | 45.80% | 0.00% | 0.22% | NA |
| Indica III | 913 | 82.30% | 17.20% | 0.44% | 0.11% | NA |
| Indica Intermediate | 786 | 56.50% | 41.90% | 1.65% | 0.00% | NA |
| Temperate Japonica | 767 | 96.90% | 2.60% | 0.52% | 0.00% | NA |
| Tropical Japonica | 504 | 46.80% | 33.10% | 12.50% | 7.54% | NA |
| Japonica Intermediate | 241 | 62.70% | 30.70% | 2.49% | 4.15% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 67.80% | 27.80% | 2.22% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0106807221 | C -> T | LOC_Os01g12430-LOC_Os01g12440 | intergenic_region ; MODIFIER | silent_mutation | Average:60.855; most accessible tissue: Callus, score: 94.1 | N | N | N | N |
| vg0106807221 | C -> DEL | N | N | silent_mutation | Average:60.855; most accessible tissue: Callus, score: 94.1 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0106807221 | NA | 4.48E-10 | mr1017 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106807221 | NA | 1.40E-09 | mr1022 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106807221 | NA | 4.88E-08 | mr1236 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106807221 | NA | 3.68E-09 | mr1518 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106807221 | NA | 9.30E-10 | mr1676 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106807221 | NA | 1.04E-07 | mr1746 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106807221 | 6.90E-06 | NA | mr1769 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106807221 | 1.15E-18 | 4.01E-33 | mr1769 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106807221 | NA | 7.43E-07 | mr1925 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106807221 | 2.95E-06 | 2.72E-12 | mr1951 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106807221 | NA | 4.93E-06 | mr1389_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106807221 | 6.39E-13 | 1.04E-15 | mr1498_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106807221 | NA | 4.37E-09 | mr1676_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106807221 | 1.29E-07 | NA | mr1769_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106807221 | 4.65E-27 | 2.25E-47 | mr1769_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106807221 | NA | 7.97E-11 | mr1916_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106807221 | 8.41E-09 | 1.08E-09 | mr1951_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |