\
| Variant ID: vg0106781087 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 6781087 |
| Reference Allele: A | Alternative Allele: C |
| Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, A: 0.04, others allele: 0.00, population size: 51. )
ATCTAGACATATATATCTATCTGGATTCATTAACATCAATATGAATGTGGGAAATGTTAGAATAACTTACATTGTGAAACGGAGGGAGTAATAAATTTAA[A/C]
GATTCAAAATTACGTGAAACTTACATACAAGTTATACTGTAGTTACATGCAAGTTACAATGTAATTACACTACGATTGTACTATAATTACATCTGTTAAA
TTTAACAGATGTAATTATAGTACAATCGTAGTGTAATTACATTGTAACTTGCATGTAACTACAGTATAACTTGTATGTAAGTTTCACGTAATTTTGAATC[T/G]
TTAAATTTATTACTCCCTCCGTTTCACAATGTAAGTTATTCTAACATTTCCCACATTCATATTGATGTTAATGAATCCAGATAGATATATATGTCTAGAT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 35.20% | 2.50% | 3.15% | 59.16% | NA |
| All Indica | 2759 | 5.50% | 4.20% | 4.71% | 85.57% | NA |
| All Japonica | 1512 | 73.70% | 0.10% | 1.06% | 25.13% | NA |
| Aus | 269 | 98.10% | 0.00% | 0.00% | 1.86% | NA |
| Indica I | 595 | 1.80% | 2.00% | 8.40% | 87.73% | NA |
| Indica II | 465 | 3.00% | 5.60% | 3.01% | 88.39% | NA |
| Indica III | 913 | 7.10% | 4.40% | 2.74% | 85.76% | NA |
| Indica Intermediate | 786 | 7.80% | 5.00% | 5.22% | 82.06% | NA |
| Temperate Japonica | 767 | 96.70% | 0.00% | 0.00% | 3.26% | NA |
| Tropical Japonica | 504 | 44.80% | 0.20% | 2.38% | 52.58% | NA |
| Japonica Intermediate | 241 | 61.00% | 0.00% | 1.66% | 37.34% | NA |
| VI/Aromatic | 96 | 95.80% | 0.00% | 0.00% | 4.17% | NA |
| Intermediate | 90 | 45.60% | 0.00% | 3.33% | 51.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0106781087 | A -> DEL | N | N | silent_mutation | Average:59.599; most accessible tissue: Minghui63 panicle, score: 86.012 | N | N | N | N |
| vg0106781087 | A -> C | LOC_Os01g12400.2 | upstream_gene_variant ; 3282.0bp to feature; MODIFIER | silent_mutation | Average:59.599; most accessible tissue: Minghui63 panicle, score: 86.012 | N | N | N | N |
| vg0106781087 | A -> C | LOC_Os01g12410.1 | downstream_gene_variant ; 832.0bp to feature; MODIFIER | silent_mutation | Average:59.599; most accessible tissue: Minghui63 panicle, score: 86.012 | N | N | N | N |
| vg0106781087 | A -> C | LOC_Os01g12400-LOC_Os01g12410 | intergenic_region ; MODIFIER | silent_mutation | Average:59.599; most accessible tissue: Minghui63 panicle, score: 86.012 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0106781087 | NA | 6.53E-21 | mr1179 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106781087 | NA | 3.03E-19 | mr1422 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106781087 | 8.32E-07 | NA | mr1769 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106781087 | NA | 1.12E-06 | mr1796 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106781087 | 8.97E-06 | 4.93E-09 | mr1925 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106781087 | NA | 1.63E-36 | mr1208_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106781087 | NA | 6.22E-30 | mr1270_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106781087 | 5.72E-09 | 6.09E-09 | mr1498_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106781087 | NA | 9.74E-17 | mr1720_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106781087 | 1.04E-14 | NA | mr1769_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106781087 | NA | 3.79E-08 | mr1925_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106781087 | NA | 1.14E-34 | mr1932_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106781087 | 1.34E-07 | NA | mr1951_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |