\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0106781087:

Variant ID: vg0106781087 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 6781087
Reference Allele: AAlternative Allele: C
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, A: 0.04, others allele: 0.00, population size: 51. )

Flanking Sequence (100 bp) in Reference Genome:


ATCTAGACATATATATCTATCTGGATTCATTAACATCAATATGAATGTGGGAAATGTTAGAATAACTTACATTGTGAAACGGAGGGAGTAATAAATTTAA[A/C]
GATTCAAAATTACGTGAAACTTACATACAAGTTATACTGTAGTTACATGCAAGTTACAATGTAATTACACTACGATTGTACTATAATTACATCTGTTAAA

Reverse complement sequence

TTTAACAGATGTAATTATAGTACAATCGTAGTGTAATTACATTGTAACTTGCATGTAACTACAGTATAACTTGTATGTAAGTTTCACGTAATTTTGAATC[T/G]
TTAAATTTATTACTCCCTCCGTTTCACAATGTAAGTTATTCTAACATTTCCCACATTCATATTGATGTTAATGAATCCAGATAGATATATATGTCTAGAT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 35.20% 2.50% 3.15% 59.16% NA
All Indica  2759 5.50% 4.20% 4.71% 85.57% NA
All Japonica  1512 73.70% 0.10% 1.06% 25.13% NA
Aus  269 98.10% 0.00% 0.00% 1.86% NA
Indica I  595 1.80% 2.00% 8.40% 87.73% NA
Indica II  465 3.00% 5.60% 3.01% 88.39% NA
Indica III  913 7.10% 4.40% 2.74% 85.76% NA
Indica Intermediate  786 7.80% 5.00% 5.22% 82.06% NA
Temperate Japonica  767 96.70% 0.00% 0.00% 3.26% NA
Tropical Japonica  504 44.80% 0.20% 2.38% 52.58% NA
Japonica Intermediate  241 61.00% 0.00% 1.66% 37.34% NA
VI/Aromatic  96 95.80% 0.00% 0.00% 4.17% NA
Intermediate  90 45.60% 0.00% 3.33% 51.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0106781087 A -> DEL N N silent_mutation Average:59.599; most accessible tissue: Minghui63 panicle, score: 86.012 N N N N
vg0106781087 A -> C LOC_Os01g12400.2 upstream_gene_variant ; 3282.0bp to feature; MODIFIER silent_mutation Average:59.599; most accessible tissue: Minghui63 panicle, score: 86.012 N N N N
vg0106781087 A -> C LOC_Os01g12410.1 downstream_gene_variant ; 832.0bp to feature; MODIFIER silent_mutation Average:59.599; most accessible tissue: Minghui63 panicle, score: 86.012 N N N N
vg0106781087 A -> C LOC_Os01g12400-LOC_Os01g12410 intergenic_region ; MODIFIER silent_mutation Average:59.599; most accessible tissue: Minghui63 panicle, score: 86.012 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0106781087 NA 6.53E-21 mr1179 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106781087 NA 3.03E-19 mr1422 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106781087 8.32E-07 NA mr1769 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106781087 NA 1.12E-06 mr1796 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106781087 8.97E-06 4.93E-09 mr1925 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106781087 NA 1.63E-36 mr1208_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106781087 NA 6.22E-30 mr1270_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106781087 5.72E-09 6.09E-09 mr1498_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106781087 NA 9.74E-17 mr1720_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106781087 1.04E-14 NA mr1769_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106781087 NA 3.79E-08 mr1925_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106781087 NA 1.14E-34 mr1932_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106781087 1.34E-07 NA mr1951_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251