Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0106777731:

Variant ID: vg0106777731 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 6777731
Reference Allele: AAlternative Allele: C
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, A: 0.00, others allele: 0.00, population size: 304. )

Flanking Sequence (100 bp) in Reference Genome:


CCCTTAAGGGAGAGAATATGTGGTGTTAACAAGAGATTTGTCACTACGGGAAGAATTATTGGCCAATTTTAGCATCTTAGGAATTTAAATCAACATAAGG[A/C]
AGGAAAATGGAACGAGCAGACCATTCTTACTCGATAGGTAGACCGTTTCTGACTTTATGAGACATTTGCATCCCACAACCCAACATGATCTGTTCCAAGT

Reverse complement sequence

ACTTGGAACAGATCATGTTGGGTTGTGGGATGCAAATGTCTCATAAAGTCAGAAACGGTCTACCTATCGAGTAAGAATGGTCTGCTCGTTCCATTTTCCT[T/G]
CCTTATGTTGATTTAAATTCCTAAGATGCTAAAATTGGCCAATAATTCTTCCCGTAGTGACAAATCTCTTGTTAACACCACATATTCTCTCCCTTAAGGG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.10% 33.90% 0.02% 0.00% NA
All Indica  2759 95.90% 4.10% 0.04% 0.00% NA
All Japonica  1512 27.10% 72.90% 0.00% 0.00% NA
Aus  269 1.90% 98.10% 0.00% 0.00% NA
Indica I  595 99.70% 0.30% 0.00% 0.00% NA
Indica II  465 98.50% 1.50% 0.00% 0.00% NA
Indica III  913 94.50% 5.40% 0.11% 0.00% NA
Indica Intermediate  786 93.10% 6.90% 0.00% 0.00% NA
Temperate Japonica  767 3.40% 96.60% 0.00% 0.00% NA
Tropical Japonica  504 57.30% 42.70% 0.00% 0.00% NA
Japonica Intermediate  241 39.00% 61.00% 0.00% 0.00% NA
VI/Aromatic  96 6.20% 93.80% 0.00% 0.00% NA
Intermediate  90 64.40% 35.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0106777731 A -> C LOC_Os01g12410.1 downstream_gene_variant ; 4188.0bp to feature; MODIFIER silent_mutation Average:48.814; most accessible tissue: Callus, score: 80.235 N N N N
vg0106777731 A -> C LOC_Os01g12400.2 intron_variant ; MODIFIER silent_mutation Average:48.814; most accessible tissue: Callus, score: 80.235 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0106777731 NA 8.57E-11 mr1017 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106777731 NA 2.31E-10 mr1022 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106777731 NA 2.60E-11 mr1055 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106777731 NA 1.66E-10 mr1132 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106777731 NA 8.67E-15 mr1156 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106777731 NA 3.09E-22 mr1179 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106777731 NA 1.47E-08 mr1236 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106777731 NA 6.45E-19 mr1422 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106777731 1.06E-08 NA mr1498 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106777731 NA 1.40E-08 mr1518 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106777731 NA 8.07E-10 mr1676 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106777731 NA 1.36E-08 mr1746 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106777731 1.54E-17 4.05E-15 mr1769 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106777731 7.93E-19 3.20E-32 mr1769 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106777731 3.67E-06 NA mr1778 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106777731 5.15E-08 2.83E-11 mr1925 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106777731 8.27E-06 3.54E-07 mr1925 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106777731 2.60E-08 3.47E-07 mr1951 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106777731 7.62E-08 2.75E-13 mr1951 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106777731 4.91E-06 NA mr1236_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106777731 NA 9.76E-27 mr1270_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106777731 3.73E-14 9.23E-13 mr1498_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106777731 1.71E-12 2.99E-15 mr1498_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106777731 NA 2.70E-10 mr1676_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106777731 NA 4.73E-15 mr1720_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106777731 6.60E-32 6.92E-17 mr1769_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106777731 1.11E-26 2.70E-44 mr1769_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106777731 NA 1.05E-09 mr1916_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106777731 1.54E-07 1.84E-09 mr1925_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106777731 NA 9.65E-33 mr1932_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106777731 4.27E-12 NA mr1951_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106777731 1.37E-08 2.24E-09 mr1951_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251