\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0106743514:

Variant ID: vg0106743514 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 6743514
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.03, others allele: 0.00, population size: 97. )

Flanking Sequence (100 bp) in Reference Genome:


CAATAGAACAAAACATTACCACGGTTACAAACAGCTGCCTTAGTTGGTAGGAGGACGCAGACACAATAGCCTCATCAAAGAGCAAGTGCCACTCGTTATC[A/G]
TTCTCATGAAGCCCTCTTGCCTCGCATGCTTGTCTAAAAGTTGGGTAAACAACACCCTCGTAGGTCCTTATATCGGCAAAGCACGTCGCACCCTTTACTA

Reverse complement sequence

TAGTAAAGGGTGCGACGTGCTTTGCCGATATAAGGACCTACGAGGGTGTTGTTTACCCAACTTTTAGACAAGCATGCGAGGCAAGAGGGCTTCATGAGAA[T/C]
GATAACGAGTGGCACTTGCTCTTTGATGAGGCTATTGTGTCTGCGTCCTCCTACCAACTAAGGCAGCTGTTTGTAACCGTGGTAATGTTTTGTTCTATTG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.40% 1.00% 2.96% 37.66% NA
All Indica  2759 42.70% 1.70% 4.78% 50.78% NA
All Japonica  1512 76.30% 0.00% 0.46% 23.28% NA
Aus  269 99.30% 0.00% 0.00% 0.74% NA
Indica I  595 18.30% 0.20% 2.69% 78.82% NA
Indica II  465 65.20% 2.20% 7.96% 24.73% NA
Indica III  913 36.40% 3.10% 4.93% 55.64% NA
Indica Intermediate  786 55.30% 1.00% 4.33% 39.31% NA
Temperate Japonica  767 98.20% 0.00% 0.00% 1.83% NA
Tropical Japonica  504 49.20% 0.00% 1.19% 49.60% NA
Japonica Intermediate  241 63.10% 0.00% 0.41% 36.51% NA
VI/Aromatic  96 95.80% 0.00% 0.00% 4.17% NA
Intermediate  90 75.60% 0.00% 1.11% 23.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0106743514 A -> G LOC_Os01g12340.1 synonymous_variant ; p.Asn734Asn; LOW synonymous_codon Average:32.232; most accessible tissue: Zhenshan97 root, score: 55.432 N N N N
vg0106743514 A -> DEL LOC_Os01g12340.1 N frameshift_variant Average:32.232; most accessible tissue: Zhenshan97 root, score: 55.432 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0106743514 4.27E-07 NA mr1498 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106743514 8.78E-07 2.76E-10 mr1769 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106743514 NA 3.28E-11 mr1925 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106743514 6.74E-06 3.43E-09 mr1951 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106743514 2.63E-08 5.23E-06 mr1236_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106743514 3.84E-06 1.86E-08 mr1236_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106743514 9.66E-15 6.11E-18 mr1498_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106743514 1.38E-08 1.28E-08 mr1498_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106743514 NA 4.25E-06 mr1636_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106743514 NA 5.95E-07 mr1763_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106743514 5.56E-16 1.22E-15 mr1769_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106743514 3.10E-06 NA mr1769_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106743514 2.10E-06 2.12E-15 mr1769_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106743514 6.04E-11 1.22E-14 mr1925_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106743514 2.15E-07 7.05E-08 mr1925_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106743514 9.99E-11 1.53E-08 mr1951_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106743514 6.60E-07 5.80E-07 mr1951_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106743514 NA 2.10E-07 mr1959_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251