\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0106731234:

Variant ID: vg0106731234 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 6731234
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCTGCTACGGTAATCCCATCCCGATGAGTGTGTGCACACGCAGGCTGTTGATCCCGATGAGTGTGTGCACACGTGTTGGGAGAGTAGGCCTCCGAAACCA[C/T]
GAACTGTTGCGACGTTTGCACGGACGGGCGGGCGATCAGGTTTTTGGGAGCGCAAGGTGCGACTACTCACTGTTCGTCAACGTCTACTTCGTCTTCACCA

Reverse complement sequence

TGGTGAAGACGAAGTAGACGTTGACGAACAGTGAGTAGTCGCACCTTGCGCTCCCAAAAACCTGATCGCCCGCCCGTCCGTGCAAACGTCGCAACAGTTC[G/A]
TGGTTTCGGAGGCCTACTCTCCCAACACGTGTGCACACACTCATCGGGATCAACAGCCTGCGTGTGCACACACTCATCGGGATGGGATTACCGTAGCAGC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.50% 8.50% 0.04% 0.00% NA
All Indica  2759 98.70% 1.20% 0.07% 0.00% NA
All Japonica  1512 76.40% 23.60% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.60% 0.40% 0.00% 0.00% NA
Indica III  913 99.20% 0.50% 0.22% 0.00% NA
Indica Intermediate  786 96.60% 3.40% 0.00% 0.00% NA
Temperate Japonica  767 98.30% 1.70% 0.00% 0.00% NA
Tropical Japonica  504 49.20% 50.80% 0.00% 0.00% NA
Japonica Intermediate  241 63.50% 36.50% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 90.00% 10.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0106731234 C -> T LOC_Os01g12320.1 upstream_gene_variant ; 2608.0bp to feature; MODIFIER silent_mutation Average:52.957; most accessible tissue: Zhenshan97 root, score: 69.506 N N N N
vg0106731234 C -> T LOC_Os01g12330.1 upstream_gene_variant ; 918.0bp to feature; MODIFIER silent_mutation Average:52.957; most accessible tissue: Zhenshan97 root, score: 69.506 N N N N
vg0106731234 C -> T LOC_Os01g12320.3 upstream_gene_variant ; 3591.0bp to feature; MODIFIER silent_mutation Average:52.957; most accessible tissue: Zhenshan97 root, score: 69.506 N N N N
vg0106731234 C -> T LOC_Os01g12320.2 upstream_gene_variant ; 2653.0bp to feature; MODIFIER silent_mutation Average:52.957; most accessible tissue: Zhenshan97 root, score: 69.506 N N N N
vg0106731234 C -> T LOC_Os01g12340.1 downstream_gene_variant ; 4524.0bp to feature; MODIFIER silent_mutation Average:52.957; most accessible tissue: Zhenshan97 root, score: 69.506 N N N N
vg0106731234 C -> T LOC_Os01g12320-LOC_Os01g12330 intergenic_region ; MODIFIER silent_mutation Average:52.957; most accessible tissue: Zhenshan97 root, score: 69.506 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0106731234 NA 1.95E-10 mr1017 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106731234 NA 1.43E-09 mr1022 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106731234 NA 5.44E-11 mr1055 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106731234 2.58E-06 5.41E-09 mr1236 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106731234 1.21E-06 1.77E-11 mr1236 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106731234 5.98E-09 2.30E-07 mr1498 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106731234 NA 8.82E-09 mr1518 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106731234 3.28E-06 4.47E-20 mr1676 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106731234 NA 1.91E-10 mr1676 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106731234 3.92E-25 3.07E-29 mr1769 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106731234 5.23E-22 9.64E-42 mr1769 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106731234 4.71E-06 NA mr1778 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106731234 5.32E-07 NA mr1916 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106731234 NA 3.48E-08 mr1916 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106731234 6.41E-08 1.04E-06 mr1925 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106731234 2.72E-06 2.74E-08 mr1925 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106731234 1.40E-09 1.71E-13 mr1951 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106731234 1.83E-09 1.70E-17 mr1951 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106731234 NA 5.54E-07 mr1236_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106731234 NA 2.33E-06 mr1236_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106731234 9.91E-14 1.20E-11 mr1498_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106731234 1.19E-13 1.50E-16 mr1498_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106731234 2.33E-06 1.85E-21 mr1676_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106731234 NA 6.31E-11 mr1676_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106731234 2.78E-33 1.11E-40 mr1769_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106731234 4.22E-31 3.31E-58 mr1769_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106731234 6.89E-09 1.29E-25 mr1916_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106731234 8.77E-06 8.58E-14 mr1916_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106731234 1.98E-07 NA mr1925_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106731234 1.16E-08 1.04E-09 mr1951_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106731234 1.24E-08 7.54E-10 mr1951_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251