Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0106731123:

Variant ID: vg0106731123 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 6731123
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 272. )

Flanking Sequence (100 bp) in Reference Genome:

TCCTATTCCATGACTCTTACTCTGCATCTTCCATTCCTCATATAAAATGAGAATGGATTTGATCTCCCGAAGAAGAAGGGAGACACACTTTCATCCATTT[C/A]
CAAGACTGTTGCTGCTACGGTAATCCCATCCCGATGAGTGTGTGCACACGCAGGCTGTTGATCCCGATGAGTGTGTGCACACGTGTTGGGAGAGTAGGCC

Reverse complement sequence

GGCCTACTCTCCCAACACGTGTGCACACACTCATCGGGATCAACAGCCTGCGTGTGCACACACTCATCGGGATGGGATTACCGTAGCAGCAACAGTCTTG[G/T]
AAATGGATGAAAGTGTGTCTCCCTTCTTCTTCGGGAGATCAAATCCATTCTCATTTTATATGAGGAATGGAAGATGCAGAGTAAGAGTCATGGAATAGGA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	88.40%	11.60%	0.02%	0.00%	NA
All Indica	2759	93.50%	6.50%	0.00%	0.00%	NA
All Japonica	1512	76.20%	23.80%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	78.30%	21.70%	0.00%	0.00%	NA
Indica III	913	98.80%	1.20%	0.00%	0.00%	NA
Indica Intermediate	786	91.50%	8.50%	0.00%	0.00%	NA
Temperate Japonica	767	98.30%	1.70%	0.00%	0.00%	NA
Tropical Japonica	504	48.40%	51.60%	0.00%	0.00%	NA
Japonica Intermediate	241	63.90%	36.10%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	88.90%	10.00%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0106731123	C -> A	LOC_Os01g12320.1	upstream_gene_variant ; 2497.0bp to feature; MODIFIER	silent_mutation	Average:47.471; most accessible tissue: Minghui63 panicle, score: 68.46	N	N	N	N
vg0106731123	C -> A	LOC_Os01g12330.1	upstream_gene_variant ; 1029.0bp to feature; MODIFIER	silent_mutation	Average:47.471; most accessible tissue: Minghui63 panicle, score: 68.46	N	N	N	N
vg0106731123	C -> A	LOC_Os01g12320.3	upstream_gene_variant ; 3480.0bp to feature; MODIFIER	silent_mutation	Average:47.471; most accessible tissue: Minghui63 panicle, score: 68.46	N	N	N	N
vg0106731123	C -> A	LOC_Os01g12320.2	upstream_gene_variant ; 2542.0bp to feature; MODIFIER	silent_mutation	Average:47.471; most accessible tissue: Minghui63 panicle, score: 68.46	N	N	N	N
vg0106731123	C -> A	LOC_Os01g12340.1	downstream_gene_variant ; 4635.0bp to feature; MODIFIER	silent_mutation	Average:47.471; most accessible tissue: Minghui63 panicle, score: 68.46	N	N	N	N
vg0106731123	C -> A	LOC_Os01g12320-LOC_Os01g12330	intergenic_region ; MODIFIER	silent_mutation	Average:47.471; most accessible tissue: Minghui63 panicle, score: 68.46	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0106731123	NA	5.05E-09	mr1022	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106731123	NA	1.25E-06	mr1088	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106731123	2.60E-10	1.48E-15	mr1236	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106731123	NA	9.66E-07	mr1236	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106731123	1.06E-06	2.47E-11	mr1236	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106731123	NA	9.85E-06	mr1364	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106731123	8.25E-34	3.82E-45	mr1498	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106731123	1.38E-30	1.01E-52	mr1498	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106731123	9.76E-06	9.76E-06	mr1498	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106731123	NA	4.88E-09	mr1518	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106731123	NA	6.18E-06	mr1598	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106731123	NA	7.39E-11	mr1676	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106731123	6.93E-45	6.82E-81	mr1769	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106731123	9.76E-21	3.17E-44	mr1769	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106731123	2.93E-19	3.86E-38	mr1769	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106731123	NA	3.42E-06	mr1887	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106731123	4.47E-11	NA	mr1916	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106731123	7.42E-08	7.42E-08	mr1916	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106731123	3.58E-24	8.12E-31	mr1925	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106731123	7.34E-17	1.13E-22	mr1925	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106731123	5.66E-07	2.83E-09	mr1925	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106731123	1.08E-29	8.83E-52	mr1951	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106731123	6.02E-21	8.29E-34	mr1951	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106731123	1.82E-08	5.66E-16	mr1951	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106731123	9.50E-08	2.07E-09	mr1236_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106731123	NA	4.73E-07	mr1236_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106731123	1.94E-11	6.01E-18	mr1310_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106731123	7.90E-46	7.30E-59	mr1498_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106731123	6.61E-29	6.05E-44	mr1498_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106731123	1.05E-14	1.03E-17	mr1498_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106731123	NA	7.08E-11	mr1676_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106731123	9.45E-69	8.37E-112	mr1769_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106731123	4.48E-34	4.87E-61	mr1769_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106731123	2.82E-27	1.73E-52	mr1769_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106731123	7.55E-16	2.59E-26	mr1916_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106731123	3.42E-14	6.48E-16	mr1916_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106731123	NA	2.00E-12	mr1916_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106731123	7.06E-25	2.84E-23	mr1925_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106731123	1.39E-17	4.69E-21	mr1925_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106731123	1.03E-25	9.42E-37	mr1951_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106731123	1.02E-18	5.29E-29	mr1951_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106731123	3.10E-08	1.36E-09	mr1951_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251