\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0106716872:

Variant ID: vg0106716872 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 6716872
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TATTGTCCCTCATTATTAGTGTTGCATTGAGTTTCTTATGGATATTCCTTGCAAAGTTATTCGCAACTAGACCATTAGATGCCCGGAGTGGCCTCATGGT[C/T]
TTCTCGTATGCCCAAGTGAAAAACGCAACAAAAAATTTCTCTGAGAAACTTGGAGAAGGTGGTTTCGGCAGTGTTTTCAAGGGTACGTTGCCAGGTTGCT

Reverse complement sequence

AGCAACCTGGCAACGTACCCTTGAAAACACTGCCGAAACCACCTTCTCCAAGTTTCTCAGAGAAATTTTTTGTTGCGTTTTTCACTTGGGCATACGAGAA[G/A]
ACCATGAGGCCACTCCGGGCATCTAATGGTCTAGTTGCGAATAACTTTGCAAGGAATATCCATAAGAAACTCAATGCAACACTAATAATGAGGGACAATA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.20% 45.00% 0.04% 1.71% NA
All Indica  2759 37.30% 62.60% 0.00% 0.04% NA
All Japonica  1512 70.50% 24.10% 0.13% 5.29% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 14.10% 85.90% 0.00% 0.00% NA
Indica II  465 49.70% 50.30% 0.00% 0.00% NA
Indica III  913 34.80% 65.10% 0.00% 0.11% NA
Indica Intermediate  786 50.50% 49.50% 0.00% 0.00% NA
Temperate Japonica  767 87.40% 2.00% 0.26% 10.43% NA
Tropical Japonica  504 48.40% 51.60% 0.00% 0.00% NA
Japonica Intermediate  241 63.10% 36.90% 0.00% 0.00% NA
VI/Aromatic  96 93.80% 6.20% 0.00% 0.00% NA
Intermediate  90 67.80% 32.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0106716872 C -> T LOC_Os01g12290.1 downstream_gene_variant ; 2730.0bp to feature; MODIFIER silent_mutation Average:24.602; most accessible tissue: Callus, score: 42.193 N N N N
vg0106716872 C -> T LOC_Os01g12304.1 downstream_gene_variant ; 1477.0bp to feature; MODIFIER silent_mutation Average:24.602; most accessible tissue: Callus, score: 42.193 N N N N
vg0106716872 C -> T LOC_Os01g12290-LOC_Os01g12304 intergenic_region ; MODIFIER silent_mutation Average:24.602; most accessible tissue: Callus, score: 42.193 N N N N
vg0106716872 C -> DEL N N silent_mutation Average:24.602; most accessible tissue: Callus, score: 42.193 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0106716872 NA 1.61E-08 mr1022 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106716872 5.97E-06 1.13E-06 mr1236 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106716872 5.32E-08 2.80E-12 mr1236 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106716872 NA 3.97E-07 mr1443 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106716872 9.18E-13 5.07E-10 mr1498 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106716872 4.72E-06 4.72E-06 mr1498 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106716872 NA 3.54E-09 mr1518 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106716872 NA 1.25E-10 mr1676 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106716872 2.04E-13 2.47E-18 mr1769 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106716872 8.15E-16 6.52E-33 mr1769 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106716872 7.30E-09 6.65E-16 mr1925 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106716872 NA 7.49E-06 mr1925 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106716872 8.49E-08 6.32E-09 mr1925 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106716872 2.74E-10 4.74E-15 mr1951 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106716872 1.10E-07 1.64E-14 mr1951 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106716872 2.12E-08 4.63E-07 mr1236_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106716872 NA 6.89E-08 mr1236_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106716872 NA 2.81E-07 mr1236_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106716872 4.17E-20 8.55E-25 mr1498_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106716872 1.96E-07 7.48E-10 mr1498_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106716872 1.53E-14 4.16E-17 mr1498_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106716872 NA 2.55E-11 mr1676_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106716872 NA 1.45E-06 mr1763_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106716872 1.81E-24 2.56E-25 mr1769_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106716872 4.92E-07 NA mr1769_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106716872 9.07E-22 2.54E-43 mr1769_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106716872 NA 8.61E-11 mr1916_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106716872 5.78E-13 8.17E-17 mr1925_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106716872 3.62E-06 3.09E-08 mr1925_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106716872 5.21E-14 2.64E-12 mr1951_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106716872 7.95E-07 5.01E-08 mr1951_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106716872 1.17E-08 4.81E-10 mr1951_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106716872 8.09E-06 NA mr1959_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106716872 NA 2.10E-07 mr1959_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251