Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0106715630:

Variant ID: vg0106715630 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 6715630
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.66, C: 0.34, others allele: 0.00, population size: 96. )

Flanking Sequence (100 bp) in Reference Genome:

TAGTTTTAGCGAGAAATCTCATTCAAATGAAGAAGGGAAACAAGTGCAAGCCTTTGCTGTTGTCCTCCTCCACGGTAATACTTCTATCATCCACCATCTT[C/T]
ATACATCTCGTGTGCCAGTTAGCATTTGCAACTAGTGCAACAGATACCCTCCTACCAGGCCAATCTCTGCGTGGAAACCAAACTTTAGTCTCAAAAGATA

Reverse complement sequence

TATCTTTTGAGACTAAAGTTTGGTTTCCACGCAGAGATTGGCCTGGTAGGAGGGTATCTGTTGCACTAGTTGCAAATGCTAACTGGCACACGAGATGTAT[G/A]
AAGATGGTGGATGATAGAAGTATTACCGTGGAGGAGGACAACAGCAAAGGCTTGCACTTGTTTCCCTTCTTCATTTGAATGAGATTTCTCGCTAAAACTA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	52.70%	45.30%	0.34%	1.63%	NA
All Indica	2759	36.70%	63.00%	0.29%	0.07%	NA
All Japonica	1512	70.40%	24.30%	0.33%	4.96%	NA
Aus	269	99.30%	0.70%	0.00%	0.00%	NA
Indica I	595	13.40%	86.40%	0.17%	0.00%	NA
Indica II	465	49.00%	50.80%	0.22%	0.00%	NA
Indica III	913	34.40%	65.30%	0.22%	0.11%	NA
Indica Intermediate	786	49.60%	49.70%	0.51%	0.13%	NA
Temperate Japonica	767	87.60%	2.10%	0.52%	9.78%	NA
Tropical Japonica	504	47.80%	52.20%	0.00%	0.00%	NA
Japonica Intermediate	241	62.70%	36.90%	0.41%	0.00%	NA
VI/Aromatic	96	93.80%	6.20%	0.00%	0.00%	NA
Intermediate	90	63.30%	33.30%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0106715630	C -> T	LOC_Os01g12280.1	upstream_gene_variant ; 4829.0bp to feature; MODIFIER	silent_mutation	Average:29.731; most accessible tissue: Callus, score: 75.328	N	N	N	N
vg0106715630	C -> T	LOC_Os01g12290.1	downstream_gene_variant ; 1488.0bp to feature; MODIFIER	silent_mutation	Average:29.731; most accessible tissue: Callus, score: 75.328	N	N	N	N
vg0106715630	C -> T	LOC_Os01g12304.1	downstream_gene_variant ; 2719.0bp to feature; MODIFIER	silent_mutation	Average:29.731; most accessible tissue: Callus, score: 75.328	N	N	N	N
vg0106715630	C -> T	LOC_Os01g12290-LOC_Os01g12304	intergenic_region ; MODIFIER	silent_mutation	Average:29.731; most accessible tissue: Callus, score: 75.328	N	N	N	N
vg0106715630	C -> DEL	N	N	silent_mutation	Average:29.731; most accessible tissue: Callus, score: 75.328	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0106715630	NA	4.50E-08	mr1022	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715630	NA	3.03E-06	mr1236	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715630	NA	1.31E-09	mr1236	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715630	NA	1.55E-07	mr1364	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715630	NA	8.93E-08	mr1443	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715630	7.39E-13	4.87E-10	mr1498	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715630	4.23E-06	NA	mr1498	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715630	4.07E-06	4.07E-06	mr1498	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715630	NA	4.01E-07	mr1518	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715630	NA	2.81E-08	mr1676	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715630	2.30E-14	5.53E-18	mr1769	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715630	7.30E-16	8.81E-33	mr1769	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715630	1.45E-09	9.19E-17	mr1925	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715630	NA	6.41E-06	mr1925	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715630	6.52E-08	1.62E-10	mr1925	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715630	2.43E-10	1.60E-14	mr1951	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715630	2.18E-07	2.31E-13	mr1951	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715630	2.78E-09	2.01E-07	mr1236_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715630	NA	2.87E-08	mr1236_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715630	9.18E-06	1.33E-07	mr1236_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715630	7.12E-20	6.56E-25	mr1498_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715630	5.28E-08	1.10E-09	mr1498_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715630	4.96E-15	2.18E-18	mr1498_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715630	NA	6.47E-08	mr1676_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715630	NA	2.25E-06	mr1763_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715630	1.77E-26	3.72E-25	mr1769_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715630	2.44E-07	NA	mr1769_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715630	4.46E-22	1.38E-44	mr1769_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715630	NA	3.33E-10	mr1916_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715630	1.41E-13	1.82E-17	mr1925_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715630	1.03E-06	2.24E-08	mr1925_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715630	3.32E-06	3.32E-06	mr1925_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715630	3.28E-14	3.74E-12	mr1951_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715630	3.45E-07	4.91E-08	mr1951_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715630	2.74E-08	1.37E-09	mr1951_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715630	9.67E-06	NA	mr1959_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715630	NA	1.23E-07	mr1959_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251