\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0106715630:

Variant ID: vg0106715630 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 6715630
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.66, C: 0.34, others allele: 0.00, population size: 96. )

Flanking Sequence (100 bp) in Reference Genome:


TAGTTTTAGCGAGAAATCTCATTCAAATGAAGAAGGGAAACAAGTGCAAGCCTTTGCTGTTGTCCTCCTCCACGGTAATACTTCTATCATCCACCATCTT[C/T]
ATACATCTCGTGTGCCAGTTAGCATTTGCAACTAGTGCAACAGATACCCTCCTACCAGGCCAATCTCTGCGTGGAAACCAAACTTTAGTCTCAAAAGATA

Reverse complement sequence

TATCTTTTGAGACTAAAGTTTGGTTTCCACGCAGAGATTGGCCTGGTAGGAGGGTATCTGTTGCACTAGTTGCAAATGCTAACTGGCACACGAGATGTAT[G/A]
AAGATGGTGGATGATAGAAGTATTACCGTGGAGGAGGACAACAGCAAAGGCTTGCACTTGTTTCCCTTCTTCATTTGAATGAGATTTCTCGCTAAAACTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.70% 45.30% 0.34% 1.63% NA
All Indica  2759 36.70% 63.00% 0.29% 0.07% NA
All Japonica  1512 70.40% 24.30% 0.33% 4.96% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 13.40% 86.40% 0.17% 0.00% NA
Indica II  465 49.00% 50.80% 0.22% 0.00% NA
Indica III  913 34.40% 65.30% 0.22% 0.11% NA
Indica Intermediate  786 49.60% 49.70% 0.51% 0.13% NA
Temperate Japonica  767 87.60% 2.10% 0.52% 9.78% NA
Tropical Japonica  504 47.80% 52.20% 0.00% 0.00% NA
Japonica Intermediate  241 62.70% 36.90% 0.41% 0.00% NA
VI/Aromatic  96 93.80% 6.20% 0.00% 0.00% NA
Intermediate  90 63.30% 33.30% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0106715630 C -> T LOC_Os01g12280.1 upstream_gene_variant ; 4829.0bp to feature; MODIFIER silent_mutation Average:29.731; most accessible tissue: Callus, score: 75.328 N N N N
vg0106715630 C -> T LOC_Os01g12290.1 downstream_gene_variant ; 1488.0bp to feature; MODIFIER silent_mutation Average:29.731; most accessible tissue: Callus, score: 75.328 N N N N
vg0106715630 C -> T LOC_Os01g12304.1 downstream_gene_variant ; 2719.0bp to feature; MODIFIER silent_mutation Average:29.731; most accessible tissue: Callus, score: 75.328 N N N N
vg0106715630 C -> T LOC_Os01g12290-LOC_Os01g12304 intergenic_region ; MODIFIER silent_mutation Average:29.731; most accessible tissue: Callus, score: 75.328 N N N N
vg0106715630 C -> DEL N N silent_mutation Average:29.731; most accessible tissue: Callus, score: 75.328 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0106715630 NA 4.50E-08 mr1022 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715630 NA 3.03E-06 mr1236 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715630 NA 1.31E-09 mr1236 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715630 NA 1.55E-07 mr1364 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715630 NA 8.93E-08 mr1443 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715630 7.39E-13 4.87E-10 mr1498 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715630 4.23E-06 NA mr1498 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715630 4.07E-06 4.07E-06 mr1498 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715630 NA 4.01E-07 mr1518 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715630 NA 2.81E-08 mr1676 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715630 2.30E-14 5.53E-18 mr1769 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715630 7.30E-16 8.81E-33 mr1769 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715630 1.45E-09 9.19E-17 mr1925 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715630 NA 6.41E-06 mr1925 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715630 6.52E-08 1.62E-10 mr1925 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715630 2.43E-10 1.60E-14 mr1951 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715630 2.18E-07 2.31E-13 mr1951 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715630 2.78E-09 2.01E-07 mr1236_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715630 NA 2.87E-08 mr1236_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715630 9.18E-06 1.33E-07 mr1236_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715630 7.12E-20 6.56E-25 mr1498_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715630 5.28E-08 1.10E-09 mr1498_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715630 4.96E-15 2.18E-18 mr1498_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715630 NA 6.47E-08 mr1676_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715630 NA 2.25E-06 mr1763_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715630 1.77E-26 3.72E-25 mr1769_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715630 2.44E-07 NA mr1769_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715630 4.46E-22 1.38E-44 mr1769_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715630 NA 3.33E-10 mr1916_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715630 1.41E-13 1.82E-17 mr1925_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715630 1.03E-06 2.24E-08 mr1925_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715630 3.32E-06 3.32E-06 mr1925_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715630 3.28E-14 3.74E-12 mr1951_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715630 3.45E-07 4.91E-08 mr1951_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715630 2.74E-08 1.37E-09 mr1951_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715630 9.67E-06 NA mr1959_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715630 NA 1.23E-07 mr1959_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251