\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0106715029:

Variant ID: vg0106715029 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 6715029
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.75, A: 0.23, others allele: 0.00, population size: 53. )

Flanking Sequence (100 bp) in Reference Genome:


CGTCTCTCCGCCGCCGTTGTTACCGACGCCAGACGGCCAGAGTGTCCCTAATCTGTAGCCGGCTGTGTCGAGGTTGGGTGCCCGTCTAGACGAAGCCAAG[G/A]
TGTTCGACGAAATGGCTCAACAACGAGGGGGGCATCACCAGCGGCATGCCGGACTGCGTATCCCAGGTAACTGTGCCTTCAACCTTAGGGACGAACATCT

Reverse complement sequence

AGATGTTCGTCCCTAAGGTTGAAGGCACAGTTACCTGGGATACGCAGTCCGGCATGCCGCTGGTGATGCCCCCCTCGTTGTTGAGCCATTTCGTCGAACA[C/T]
CTTGGCTTCGTCTAGACGGGCACCCAACCTCGACACAGCCGGCTACAGATTAGGGACACTCTGGCCGTCTGGCGTCGGTAACAACGGCGGCGGAGAGACG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.20% 45.00% 0.08% 1.63% NA
All Indica  2759 37.40% 62.60% 0.00% 0.00% NA
All Japonica  1512 70.40% 24.30% 0.26% 5.09% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 14.30% 85.70% 0.00% 0.00% NA
Indica II  465 49.90% 50.10% 0.00% 0.00% NA
Indica III  913 34.80% 65.20% 0.00% 0.00% NA
Indica Intermediate  786 50.50% 49.50% 0.00% 0.00% NA
Temperate Japonica  767 87.50% 2.00% 0.52% 10.04% NA
Tropical Japonica  504 47.80% 52.20% 0.00% 0.00% NA
Japonica Intermediate  241 63.10% 36.90% 0.00% 0.00% NA
VI/Aromatic  96 94.80% 5.20% 0.00% 0.00% NA
Intermediate  90 68.90% 31.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0106715029 G -> A LOC_Os01g12280.1 upstream_gene_variant ; 4228.0bp to feature; MODIFIER silent_mutation Average:51.831; most accessible tissue: Callus, score: 98.157 N N N N
vg0106715029 G -> A LOC_Os01g12290.1 downstream_gene_variant ; 887.0bp to feature; MODIFIER silent_mutation Average:51.831; most accessible tissue: Callus, score: 98.157 N N N N
vg0106715029 G -> A LOC_Os01g12304.1 downstream_gene_variant ; 3320.0bp to feature; MODIFIER silent_mutation Average:51.831; most accessible tissue: Callus, score: 98.157 N N N N
vg0106715029 G -> A LOC_Os01g12290-LOC_Os01g12304 intergenic_region ; MODIFIER silent_mutation Average:51.831; most accessible tissue: Callus, score: 98.157 N N N N
vg0106715029 G -> DEL N N silent_mutation Average:51.831; most accessible tissue: Callus, score: 98.157 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0106715029 NA 5.94E-09 mr1022 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715029 NA 8.71E-07 mr1236 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715029 3.11E-06 1.36E-10 mr1236 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715029 NA 2.37E-08 mr1364 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715029 NA 4.74E-08 mr1443 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715029 1.91E-11 4.77E-12 mr1498 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715029 NA 4.01E-09 mr1498 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715029 NA 1.63E-08 mr1518 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715029 9.41E-06 NA mr1676 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715029 NA 1.84E-10 mr1676 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715029 NA 1.43E-06 mr1734 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715029 NA 1.91E-07 mr1746 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715029 2.64E-12 1.04E-21 mr1769 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715029 7.29E-21 1.70E-39 mr1769 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715029 NA 1.13E-07 mr1800 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715029 NA 1.41E-07 mr1916 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715029 3.54E-07 3.80E-16 mr1925 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715029 NA 8.51E-06 mr1925 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715029 1.87E-06 1.89E-08 mr1925 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715029 4.63E-09 1.12E-16 mr1951 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715029 1.34E-08 8.34E-16 mr1951 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715029 1.30E-07 1.25E-07 mr1236_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715029 NA 2.35E-08 mr1236_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715029 NA 2.52E-06 mr1236_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715029 3.25E-17 1.82E-27 mr1498_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715029 2.22E-07 7.98E-11 mr1498_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715029 6.45E-14 8.23E-17 mr1498_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715029 NA 3.43E-11 mr1676_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715029 NA 3.24E-06 mr1763_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715029 1.83E-22 3.86E-32 mr1769_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715029 3.59E-06 NA mr1769_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715029 7.54E-30 1.15E-54 mr1769_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715029 NA 7.00E-06 mr1795_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715029 NA 1.82E-12 mr1916_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715029 2.29E-12 3.07E-18 mr1925_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715029 1.04E-06 2.82E-09 mr1925_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715029 1.85E-15 2.24E-16 mr1951_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715029 1.48E-08 3.51E-10 mr1951_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715029 7.56E-09 6.11E-10 mr1951_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715029 NA 4.25E-07 mr1959_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251