Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0106715029:

Variant ID: vg0106715029 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 6715029
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.75, A: 0.23, others allele: 0.00, population size: 53. )

Flanking Sequence (100 bp) in Reference Genome:

CGTCTCTCCGCCGCCGTTGTTACCGACGCCAGACGGCCAGAGTGTCCCTAATCTGTAGCCGGCTGTGTCGAGGTTGGGTGCCCGTCTAGACGAAGCCAAG[G/A]
TGTTCGACGAAATGGCTCAACAACGAGGGGGGCATCACCAGCGGCATGCCGGACTGCGTATCCCAGGTAACTGTGCCTTCAACCTTAGGGACGAACATCT

Reverse complement sequence

AGATGTTCGTCCCTAAGGTTGAAGGCACAGTTACCTGGGATACGCAGTCCGGCATGCCGCTGGTGATGCCCCCCTCGTTGTTGAGCCATTTCGTCGAACA[C/T]
CTTGGCTTCGTCTAGACGGGCACCCAACCTCGACACAGCCGGCTACAGATTAGGGACACTCTGGCCGTCTGGCGTCGGTAACAACGGCGGCGGAGAGACG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	53.20%	45.00%	0.08%	1.63%	NA
All Indica	2759	37.40%	62.60%	0.00%	0.00%	NA
All Japonica	1512	70.40%	24.30%	0.26%	5.09%	NA
Aus	269	99.30%	0.70%	0.00%	0.00%	NA
Indica I	595	14.30%	85.70%	0.00%	0.00%	NA
Indica II	465	49.90%	50.10%	0.00%	0.00%	NA
Indica III	913	34.80%	65.20%	0.00%	0.00%	NA
Indica Intermediate	786	50.50%	49.50%	0.00%	0.00%	NA
Temperate Japonica	767	87.50%	2.00%	0.52%	10.04%	NA
Tropical Japonica	504	47.80%	52.20%	0.00%	0.00%	NA
Japonica Intermediate	241	63.10%	36.90%	0.00%	0.00%	NA
VI/Aromatic	96	94.80%	5.20%	0.00%	0.00%	NA
Intermediate	90	68.90%	31.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0106715029	G -> A	LOC_Os01g12280.1	upstream_gene_variant ; 4228.0bp to feature; MODIFIER	silent_mutation	Average:51.831; most accessible tissue: Callus, score: 98.157	N	N	N	N
vg0106715029	G -> A	LOC_Os01g12290.1	downstream_gene_variant ; 887.0bp to feature; MODIFIER	silent_mutation	Average:51.831; most accessible tissue: Callus, score: 98.157	N	N	N	N
vg0106715029	G -> A	LOC_Os01g12304.1	downstream_gene_variant ; 3320.0bp to feature; MODIFIER	silent_mutation	Average:51.831; most accessible tissue: Callus, score: 98.157	N	N	N	N
vg0106715029	G -> A	LOC_Os01g12290-LOC_Os01g12304	intergenic_region ; MODIFIER	silent_mutation	Average:51.831; most accessible tissue: Callus, score: 98.157	N	N	N	N
vg0106715029	G -> DEL	N	N	silent_mutation	Average:51.831; most accessible tissue: Callus, score: 98.157	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0106715029	NA	5.94E-09	mr1022	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715029	NA	8.71E-07	mr1236	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715029	3.11E-06	1.36E-10	mr1236	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715029	NA	2.37E-08	mr1364	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715029	NA	4.74E-08	mr1443	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715029	1.91E-11	4.77E-12	mr1498	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715029	NA	4.01E-09	mr1498	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715029	NA	1.63E-08	mr1518	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715029	9.41E-06	NA	mr1676	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715029	NA	1.84E-10	mr1676	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715029	NA	1.43E-06	mr1734	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715029	NA	1.91E-07	mr1746	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715029	2.64E-12	1.04E-21	mr1769	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715029	7.29E-21	1.70E-39	mr1769	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715029	NA	1.13E-07	mr1800	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715029	NA	1.41E-07	mr1916	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715029	3.54E-07	3.80E-16	mr1925	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715029	NA	8.51E-06	mr1925	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715029	1.87E-06	1.89E-08	mr1925	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715029	4.63E-09	1.12E-16	mr1951	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715029	1.34E-08	8.34E-16	mr1951	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715029	1.30E-07	1.25E-07	mr1236_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715029	NA	2.35E-08	mr1236_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715029	NA	2.52E-06	mr1236_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715029	3.25E-17	1.82E-27	mr1498_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715029	2.22E-07	7.98E-11	mr1498_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715029	6.45E-14	8.23E-17	mr1498_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715029	NA	3.43E-11	mr1676_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715029	NA	3.24E-06	mr1763_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715029	1.83E-22	3.86E-32	mr1769_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715029	3.59E-06	NA	mr1769_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715029	7.54E-30	1.15E-54	mr1769_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715029	NA	7.00E-06	mr1795_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715029	NA	1.82E-12	mr1916_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715029	2.29E-12	3.07E-18	mr1925_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715029	1.04E-06	2.82E-09	mr1925_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715029	1.85E-15	2.24E-16	mr1951_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715029	1.48E-08	3.51E-10	mr1951_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715029	7.56E-09	6.11E-10	mr1951_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106715029	NA	4.25E-07	mr1959_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251