\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0106681042:

Variant ID: vg0106681042 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 6681042
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.89, T: 0.11, others allele: 0.00, population size: 104. )

Flanking Sequence (100 bp) in Reference Genome:


CGTGCTCGTGCTCCTCCCGTGCCTCTCCCTGATGCCGTGTGGGGGTGGAGGAGATTAGCTGTGTGGGGCCCAACATTGGCCAGCCAAATAGAGTGGCCAA[A/T]
TTTGGCTAGTGGAGGGAGGGTTAGAGAGGCTGTTGGAGCACGTTTTATTTTGGCTAGAATGGCTAAAATTTAGATTGGAGAGTGAGATGGAGAGGCTGTT

Reverse complement sequence

AACAGCCTCTCCATCTCACTCTCCAATCTAAATTTTAGCCATTCTAGCCAAAATAAAACGTGCTCCAACAGCCTCTCTAACCCTCCCTCCACTAGCCAAA[T/A]
TTGGCCACTCTATTTGGCTGGCCAATGTTGGGCCCCACACAGCTAATCTCCTCCACCCCCACACGGCATCAGGGAGAGGCACGGGAGGAGCACGAGCACG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.30% 40.60% 0.87% 0.28% NA
All Indica  2759 62.00% 36.60% 1.05% 0.36% NA
All Japonica  1512 64.40% 34.80% 0.66% 0.13% NA
Aus  269 3.70% 96.30% 0.00% 0.00% NA
Indica I  595 87.40% 12.60% 0.00% 0.00% NA
Indica II  465 44.30% 50.30% 3.87% 1.51% NA
Indica III  913 64.60% 35.30% 0.11% 0.00% NA
Indica Intermediate  786 50.30% 48.10% 1.27% 0.38% NA
Temperate Japonica  767 70.10% 29.20% 0.39% 0.26% NA
Tropical Japonica  504 58.10% 41.10% 0.79% 0.00% NA
Japonica Intermediate  241 59.30% 39.40% 1.24% 0.00% NA
VI/Aromatic  96 12.50% 87.50% 0.00% 0.00% NA
Intermediate  90 52.20% 44.40% 2.22% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0106681042 A -> T LOC_Os01g12230-LOC_Os01g12240 intergenic_region ; MODIFIER silent_mutation Average:59.014; most accessible tissue: Minghui63 panicle, score: 84.005 N N N N
vg0106681042 A -> DEL N N silent_mutation Average:59.014; most accessible tissue: Minghui63 panicle, score: 84.005 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0106681042 NA 3.15E-06 mr1236 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106681042 3.04E-09 1.77E-13 mr1498 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106681042 1.11E-07 2.85E-09 mr1498 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106681042 NA 7.33E-07 mr1709 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106681042 8.62E-14 1.37E-11 mr1769 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106681042 7.52E-08 NA mr1769 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106681042 7.15E-07 2.41E-11 mr1925 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106681042 NA 1.25E-06 mr1925 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106681042 5.26E-07 9.27E-13 mr1951 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106681042 NA 3.82E-06 mr1236_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106681042 1.89E-11 1.08E-12 mr1498_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106681042 1.95E-08 1.33E-09 mr1498_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106681042 6.99E-14 7.44E-12 mr1769_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106681042 1.02E-07 NA mr1769_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106681042 2.60E-06 NA mr1769_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106681042 NA 6.37E-06 mr1795_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106681042 1.95E-10 2.45E-12 mr1925_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106681042 2.92E-07 5.06E-09 mr1925_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106681042 1.39E-07 5.80E-10 mr1951_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106681042 5.39E-07 4.11E-07 mr1951_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106681042 5.50E-06 NA mr1959_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106681042 NA 1.11E-07 mr1959_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251