\
| Variant ID: vg0106679567 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 6679567 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, C: 0.01, others allele: 0.00, population size: 126. )
ATCTAGACTGTTTGAAGAGCTTTTATTTCTGGAAGAAGTTACAACTGCCAGAAGCTCCTAAACAAGCCCCTAGACTAGAACTAAAGATTTTGGAAGAAAC[T/C]
ATATTTGCTAGAAGCTCTCCAAACATGATCTTAATACAAAACAAATCATAGAACATGCATAGAGATATTCTAAGTACCTATTTATAACATTGGGAAAAAC
GTTTTTCCCAATGTTATAAATAGGTACTTAGAATATCTCTATGCATGTTCTATGATTTGTTTTGTATTAAGATCATGTTTGGAGAGCTTCTAGCAAATAT[A/G]
GTTTCTTCCAAAATCTTTAGTTCTAGTCTAGGGGCTTGTTTAGGAGCTTCTGGCAGTTGTAACTTCTTCCAGAAATAAAAGCTCTTCAAACAGTCTAGAT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 78.20% | 21.40% | 0.36% | 0.00% | NA |
| All Indica | 2759 | 74.30% | 25.60% | 0.18% | 0.00% | NA |
| All Japonica | 1512 | 82.10% | 17.30% | 0.66% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 53.10% | 46.70% | 0.22% | 0.00% | NA |
| Indica III | 913 | 71.30% | 28.60% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 72.40% | 27.20% | 0.38% | 0.00% | NA |
| Temperate Japonica | 767 | 92.30% | 6.60% | 1.04% | 0.00% | NA |
| Tropical Japonica | 504 | 67.10% | 32.90% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 80.90% | 18.30% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 80.20% | 19.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 67.80% | 30.00% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0106679567 | T -> C | LOC_Os01g12230-LOC_Os01g12240 | intergenic_region ; MODIFIER | silent_mutation | Average:30.222; most accessible tissue: Callus, score: 67.56 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0106679567 | NA | 9.04E-06 | Grain_weight | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0106679567 | NA | 2.74E-06 | mr1236 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106679567 | 5.48E-07 | NA | mr1498 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106679567 | 1.39E-08 | NA | mr1769 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106679567 | 7.32E-06 | NA | mr1769 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106679567 | 1.92E-06 | NA | mr1951 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106679567 | NA | 6.60E-06 | mr1219_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106679567 | NA | 3.70E-07 | mr1236_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106679567 | NA | 5.66E-07 | mr1236_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106679567 | 5.58E-07 | NA | mr1498_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106679567 | NA | 2.95E-07 | mr1498_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106679567 | 3.20E-07 | NA | mr1769_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106679567 | 9.26E-06 | NA | mr1925_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106679567 | NA | 1.22E-06 | mr1925_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |