Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0106669651:

Variant ID: vg0106669651 (JBrowse)Variation Type: INDEL
Chromosome: chr01Position: 6669651
Reference Allele: AAlternative Allele: T,AT
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.01, others allele: 0.00, population size: 213. )

Flanking Sequence (100 bp) in Reference Genome:


ACCTGTTTACTCCCGCGAGTCAGCTCTAGTCAAATACTCCTATATTTTCTCTCCATCCTTTAAAAAAAAACAATTCTAACAACGAATCTAGTTAGATTAT[A/T,AT]
TTTTTTTTACAGGGTAGTATATATACGAGCATAGGAATATACAGTAGTCGTCTAAATTGGCATATGGGCTTAATCACCGGATGCTCCAAAAACAAGCCAT

Reverse complement sequence

ATGGCTTGTTTTTGGAGCATCCGGTGATTAAGCCCATATGCCAATTTAGACGACTACTGTATATTCCTATGCTCGTATATATACTACCCTGTAAAAAAAA[T/A,AT]
ATAATCTAACTAGATTCGTTGTTAGAATTGTTTTTTTTTAAAGGATGGAGAGAAAATATAGGAGTATTTGACTAGAGCTGACTCGCGGGAGTAAACAGGT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.80% 9.10% 0.06% 0.00% AT: 0.13%
All Indica  2759 92.80% 6.90% 0.11% 0.00% AT: 0.22%
All Japonica  1512 99.60% 0.40% 0.00% 0.00% NA
Aus  269 20.40% 79.60% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 78.30% 21.70% 0.00% 0.00% NA
Indica III  913 97.20% 2.20% 0.11% 0.00% AT: 0.55%
Indica Intermediate  786 90.80% 8.80% 0.25% 0.00% AT: 0.13%
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.00% 1.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 85.40% 14.60% 0.00% 0.00% NA
Intermediate  90 96.70% 3.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0106669651 A -> T LOC_Os01g12220.1 downstream_gene_variant ; 4191.0bp to feature; MODIFIER silent_mutation Average:75.723; most accessible tissue: Minghui63 flag leaf, score: 89.425 N N N N
vg0106669651 A -> T LOC_Os01g12230.1 intron_variant ; MODIFIER silent_mutation Average:75.723; most accessible tissue: Minghui63 flag leaf, score: 89.425 N N N N
vg0106669651 A -> AT LOC_Os01g12220.1 downstream_gene_variant ; 4192.0bp to feature; MODIFIER silent_mutation Average:75.723; most accessible tissue: Minghui63 flag leaf, score: 89.425 N N N N
vg0106669651 A -> AT LOC_Os01g12230.1 intron_variant ; MODIFIER silent_mutation Average:75.723; most accessible tissue: Minghui63 flag leaf, score: 89.425 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0106669651 A AT 0.0 0.09 0.12 0.02 0.02 0.0
vg0106669651 A T 0.0 0.01 0.02 -0.01 0.0 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0106669651 NA 8.68E-07 mr1088 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106669651 NA 2.24E-06 mr1207 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106669651 4.33E-06 5.09E-08 mr1236 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106669651 NA 8.65E-07 mr1236 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106669651 2.32E-18 6.07E-09 mr1498 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106669651 2.38E-19 1.25E-37 mr1498 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106669651 3.70E-16 1.88E-12 mr1769 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106669651 2.26E-12 5.22E-31 mr1769 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106669651 3.59E-06 NA mr1916 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106669651 2.36E-09 NA mr1925 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106669651 8.34E-09 8.32E-15 mr1925 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106669651 1.61E-14 NA mr1951 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106669651 1.77E-15 3.00E-27 mr1951 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106669651 NA 8.74E-08 mr1236_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106669651 7.06E-07 1.35E-12 mr1310_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106669651 2.25E-16 2.14E-14 mr1498_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106669651 2.77E-11 1.02E-24 mr1498_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106669651 2.39E-20 1.28E-17 mr1769_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106669651 1.21E-15 9.99E-36 mr1769_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106669651 1.41E-06 NA mr1916_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106669651 1.97E-08 6.41E-10 mr1916_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106669651 1.56E-10 1.61E-07 mr1925_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106669651 1.52E-08 7.41E-14 mr1925_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106669651 3.19E-11 5.69E-08 mr1951_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106669651 2.31E-10 8.29E-20 mr1951_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251