\
| Variant ID: vg0106635826 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 6635826 |
| Reference Allele: A | Alternative Allele: C |
| Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 227. )
TATCATAAACATGGCTAAACTTGAAAGAACATAATTAATCAACACCAGTCTACCACCAACAGATAAATGCTTGCCTTTCCAACTACTAAGCTTTTTCTCA[A/C]
TTCTCTCTTCAATAAGTTTCCAATCTTTATTAGAAAGCTTCCTAAAATGCATTGAAATTCCAAGGTATTTAAAAGGAAAGGTACCTAACTTACAACCAAA
TTTGGTTGTAAGTTAGGTACCTTTCCTTTTAAATACCTTGGAATTTCAATGCATTTTAGGAAGCTTTCTAATAAAGATTGGAAACTTATTGAAGAGAGAA[T/G]
TGAGAAAAAGCTTAGTAGTTGGAAAGGCAAGCATTTATCTGTTGGTGGTAGACTGGTGTTGATTAATTATGTTCTTTCAAGTTTAGCCATGTTTATGATA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 95.70% | 4.10% | 0.15% | 0.00% | NA |
| All Indica | 2759 | 93.00% | 6.80% | 0.25% | 0.00% | NA |
| All Japonica | 1512 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 90.60% | 8.40% | 1.01% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 83.70% | 16.20% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0106635826 | A -> C | LOC_Os01g12170.1 | intron_variant ; MODIFIER | silent_mutation | Average:17.66; most accessible tissue: Zhenshan97 flower, score: 25.055 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0106635826 | NA | 3.96E-06 | mr1013 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106635826 | NA | 1.14E-07 | mr1015 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106635826 | NA | 8.31E-06 | mr1034 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106635826 | NA | 6.68E-06 | mr1056 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106635826 | NA | 8.69E-06 | mr1296_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106635826 | NA | 4.57E-06 | mr1474_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106635826 | 7.37E-06 | 7.37E-06 | mr1738_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106635826 | NA | 8.45E-06 | mr1825_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |