\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0106608184:

Variant ID: vg0106608184 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 6608184
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.97, C: 0.03, others allele: 0.00, population size: 123. )

Flanking Sequence (100 bp) in Reference Genome:


TTACATTTTTGCTTGTCCTTGTAAACTCTGATGGGAAAAGCATTGCAGTCCTCTACTTCTATGTTCCTCTGCATGTAAATATTTGATTGGTACTCCGTAC[C/T]
CCCTCCGTCTCATATTATATTACGAGTCGCTTTGATTTTTTTATAGTCAAACTTATTTAGATTTTGATCGACTTTATAAAAAAATTATTAAATATCTACA

Reverse complement sequence

TGTAGATATTTAATAATTTTTTTATAAAGTCGATCAAAATCTAAATAAGTTTGACTATAAAAAAATCAAAGCGACTCGTAATATAATATGAGACGGAGGG[G/A]
GTACGGAGTACCAATCAAATATTTACATGCAGAGGAACATAGAAGTAGAGGACTGCAATGCTTTTCCCATCAGAGTTTACAAGGACAAGCAAAAATGTAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.00% 36.90% 0.06% 0.00% NA
All Indica  2759 57.00% 42.80% 0.11% 0.00% NA
All Japonica  1512 86.60% 13.40% 0.00% 0.00% NA
Aus  269 0.70% 99.30% 0.00% 0.00% NA
Indica I  595 41.20% 58.70% 0.17% 0.00% NA
Indica II  465 66.90% 32.90% 0.22% 0.00% NA
Indica III  913 68.50% 31.50% 0.00% 0.00% NA
Indica Intermediate  786 50.00% 49.90% 0.13% 0.00% NA
Temperate Japonica  767 99.10% 0.90% 0.00% 0.00% NA
Tropical Japonica  504 76.20% 23.80% 0.00% 0.00% NA
Japonica Intermediate  241 68.90% 31.10% 0.00% 0.00% NA
VI/Aromatic  96 29.20% 70.80% 0.00% 0.00% NA
Intermediate  90 70.00% 30.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0106608184 C -> T LOC_Os01g12120.1 upstream_gene_variant ; 945.0bp to feature; MODIFIER silent_mutation Average:42.221; most accessible tissue: Callus, score: 76.106 N N N N
vg0106608184 C -> T LOC_Os01g12130.1 downstream_gene_variant ; 4159.0bp to feature; MODIFIER silent_mutation Average:42.221; most accessible tissue: Callus, score: 76.106 N N N N
vg0106608184 C -> T LOC_Os01g12120-LOC_Os01g12130 intergenic_region ; MODIFIER silent_mutation Average:42.221; most accessible tissue: Callus, score: 76.106 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0106608184 NA 2.75E-09 mr1705_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106608184 1.06E-06 NA mr1769_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106608184 8.82E-07 NA mr1769_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106608184 NA 2.85E-06 mr1825_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106608184 NA 7.00E-06 mr1943_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251