Variant ID: vg0106608184 (JBrowse) | Variation Type: SNP |
Chromosome: chr01 | Position: 6608184 |
Reference Allele: C | Alternative Allele: T |
Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.97, C: 0.03, others allele: 0.00, population size: 123. )
TTACATTTTTGCTTGTCCTTGTAAACTCTGATGGGAAAAGCATTGCAGTCCTCTACTTCTATGTTCCTCTGCATGTAAATATTTGATTGGTACTCCGTAC[C/T]
CCCTCCGTCTCATATTATATTACGAGTCGCTTTGATTTTTTTATAGTCAAACTTATTTAGATTTTGATCGACTTTATAAAAAAATTATTAAATATCTACA
TGTAGATATTTAATAATTTTTTTATAAAGTCGATCAAAATCTAAATAAGTTTGACTATAAAAAAATCAAAGCGACTCGTAATATAATATGAGACGGAGGG[G/A]
GTACGGAGTACCAATCAAATATTTACATGCAGAGGAACATAGAAGTAGAGGACTGCAATGCTTTTCCCATCAGAGTTTACAAGGACAAGCAAAAATGTAA
Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 63.00% | 36.90% | 0.06% | 0.00% | NA |
All Indica | 2759 | 57.00% | 42.80% | 0.11% | 0.00% | NA |
All Japonica | 1512 | 86.60% | 13.40% | 0.00% | 0.00% | NA |
Aus | 269 | 0.70% | 99.30% | 0.00% | 0.00% | NA |
Indica I | 595 | 41.20% | 58.70% | 0.17% | 0.00% | NA |
Indica II | 465 | 66.90% | 32.90% | 0.22% | 0.00% | NA |
Indica III | 913 | 68.50% | 31.50% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 50.00% | 49.90% | 0.13% | 0.00% | NA |
Temperate Japonica | 767 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 76.20% | 23.80% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 68.90% | 31.10% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 29.20% | 70.80% | 0.00% | 0.00% | NA |
Intermediate | 90 | 70.00% | 30.00% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0106608184 | C -> T | LOC_Os01g12120.1 | upstream_gene_variant ; 945.0bp to feature; MODIFIER | silent_mutation | Average:42.221; most accessible tissue: Callus, score: 76.106 | N | N | N | N |
vg0106608184 | C -> T | LOC_Os01g12130.1 | downstream_gene_variant ; 4159.0bp to feature; MODIFIER | silent_mutation | Average:42.221; most accessible tissue: Callus, score: 76.106 | N | N | N | N |
vg0106608184 | C -> T | LOC_Os01g12120-LOC_Os01g12130 | intergenic_region ; MODIFIER | silent_mutation | Average:42.221; most accessible tissue: Callus, score: 76.106 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0106608184 | NA | 2.75E-09 | mr1705_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0106608184 | 1.06E-06 | NA | mr1769_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0106608184 | 8.82E-07 | NA | mr1769_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0106608184 | NA | 2.85E-06 | mr1825_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0106608184 | NA | 7.00E-06 | mr1943_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |