\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0106604863:

Variant ID: vg0106604863 (JBrowse)Variation Type: INDEL
Chromosome: chr01Position: 6604863
Reference Allele: TAlternative Allele: C,TAGTAGGAGATGTGACGAACTTAAC
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATGGCTTCATGGTTGGATATGATAGATCAGAGGTAGTGTACGGTAGTAGGATATGTTACTCAATCATGTTAGGTACTCCCACCGTCCTAAAAGAACTTAA[T/C,TAGTAGGAGATGTGACGAACTTAAC]
ATAGTAGGAGATGTGACTCCTCGTAGGACAACGAATCTGGACAAAGGGTAGTCCAGATTCATTGTCCTACGAGGGATATTACATCTTCTCCTAGGTTAAG

Reverse complement sequence

CTTAACCTAGGAGAAGATGTAATATCCCTCGTAGGACAATGAATCTGGACTACCCTTTGTCCAGATTCGTTGTCCTACGAGGAGTCACATCTCCTACTAT[A/G,GTTAAGTTCGTCACATCTCCTACTA]
TTAAGTTCTTTTAGGACGGTGGGAGTACCTAACATGATTGAGTAACATATCCTACTACCGTACACTACCTCTGATCTATCATATCCAACCATGAAGCCAT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.20% 31.70% 0.11% 0.00% TAGTAGGAGATGTGACGAACTTAAC: 0.04%
All Indica  2759 65.50% 34.30% 0.18% 0.00% NA
All Japonica  1512 87.40% 12.60% 0.00% 0.00% NA
Aus  269 0.00% 100.00% 0.00% 0.00% NA
Indica I  595 53.30% 46.40% 0.34% 0.00% NA
Indica II  465 68.00% 31.80% 0.22% 0.00% NA
Indica III  913 69.30% 30.60% 0.11% 0.00% NA
Indica Intermediate  786 68.80% 31.00% 0.13% 0.00% NA
Temperate Japonica  767 99.30% 0.70% 0.00% 0.00% NA
Tropical Japonica  504 77.40% 22.60% 0.00% 0.00% NA
Japonica Intermediate  241 70.10% 29.90% 0.00% 0.00% NA
VI/Aromatic  96 29.20% 70.80% 0.00% 0.00% NA
Intermediate  90 72.20% 25.60% 0.00% 0.00% TAGTAGGAGATGTGACGAACTTAAC: 2.22%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0106604863 T -> TAGTAGGAGATGTGACGAACTTAAC LOC_Os01g12120.1 downstream_gene_variant ; 1657.0bp to feature; MODIFIER silent_mutation Average:66.194; most accessible tissue: Callus, score: 92.322 N N N N
vg0106604863 T -> TAGTAGGAGATGTGACGAACTTAAC LOC_Os01g12110-LOC_Os01g12120 intergenic_region ; MODIFIER silent_mutation Average:66.194; most accessible tissue: Callus, score: 92.322 N N N N
vg0106604863 T -> C LOC_Os01g12120.1 downstream_gene_variant ; 1658.0bp to feature; MODIFIER silent_mutation Average:66.194; most accessible tissue: Callus, score: 92.322 N N N N
vg0106604863 T -> C LOC_Os01g12110-LOC_Os01g12120 intergenic_region ; MODIFIER silent_mutation Average:66.194; most accessible tissue: Callus, score: 92.322 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0106604863 NA 4.34E-09 mr1705_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106604863 2.02E-07 NA mr1769_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106604863 6.08E-06 NA mr1769_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106604863 3.96E-06 NA mr1951_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106604863 NA 6.93E-07 mr1951_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251