\
| Variant ID: vg0106604863 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr01 | Position: 6604863 |
| Reference Allele: T | Alternative Allele: C,TAGTAGGAGATGTGACGAACTTAAC |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
ATGGCTTCATGGTTGGATATGATAGATCAGAGGTAGTGTACGGTAGTAGGATATGTTACTCAATCATGTTAGGTACTCCCACCGTCCTAAAAGAACTTAA[T/C,TAGTAGGAGATGTGACGAACTTAAC]
ATAGTAGGAGATGTGACTCCTCGTAGGACAACGAATCTGGACAAAGGGTAGTCCAGATTCATTGTCCTACGAGGGATATTACATCTTCTCCTAGGTTAAG
CTTAACCTAGGAGAAGATGTAATATCCCTCGTAGGACAATGAATCTGGACTACCCTTTGTCCAGATTCGTTGTCCTACGAGGAGTCACATCTCCTACTAT[A/G,GTTAAGTTCGTCACATCTCCTACTA]
TTAAGTTCTTTTAGGACGGTGGGAGTACCTAACATGATTGAGTAACATATCCTACTACCGTACACTACCTCTGATCTATCATATCCAACCATGAAGCCAT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 68.20% | 31.70% | 0.11% | 0.00% | TAGTAGGAGATGTGACGAACTTAAC: 0.04% |
| All Indica | 2759 | 65.50% | 34.30% | 0.18% | 0.00% | NA |
| All Japonica | 1512 | 87.40% | 12.60% | 0.00% | 0.00% | NA |
| Aus | 269 | 0.00% | 100.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 53.30% | 46.40% | 0.34% | 0.00% | NA |
| Indica II | 465 | 68.00% | 31.80% | 0.22% | 0.00% | NA |
| Indica III | 913 | 69.30% | 30.60% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 68.80% | 31.00% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 77.40% | 22.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 70.10% | 29.90% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 29.20% | 70.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 72.20% | 25.60% | 0.00% | 0.00% | TAGTAGGAGATGTGACGAACTTAAC: 2.22% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0106604863 | T -> TAGTAGGAGATGTGACGAACTTAAC | LOC_Os01g12120.1 | downstream_gene_variant ; 1657.0bp to feature; MODIFIER | silent_mutation | Average:66.194; most accessible tissue: Callus, score: 92.322 | N | N | N | N |
| vg0106604863 | T -> TAGTAGGAGATGTGACGAACTTAAC | LOC_Os01g12110-LOC_Os01g12120 | intergenic_region ; MODIFIER | silent_mutation | Average:66.194; most accessible tissue: Callus, score: 92.322 | N | N | N | N |
| vg0106604863 | T -> C | LOC_Os01g12120.1 | downstream_gene_variant ; 1658.0bp to feature; MODIFIER | silent_mutation | Average:66.194; most accessible tissue: Callus, score: 92.322 | N | N | N | N |
| vg0106604863 | T -> C | LOC_Os01g12110-LOC_Os01g12120 | intergenic_region ; MODIFIER | silent_mutation | Average:66.194; most accessible tissue: Callus, score: 92.322 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0106604863 | NA | 4.34E-09 | mr1705_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106604863 | 2.02E-07 | NA | mr1769_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106604863 | 6.08E-06 | NA | mr1769_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106604863 | 3.96E-06 | NA | mr1951_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106604863 | NA | 6.93E-07 | mr1951_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |