\
| Variant ID: vg0106589855 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 6589855 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TGAAATTTTAATATGATTTTTTTAATTTTTTTTATGAATTATGAGTTTATTTCATATTTACGTTAGAATAATTGTTTAACCTTTTGTTTAAGAAACATGG[G/A]
ACTTTGTTTAAATAAGTAATAGTGTGTAATGAGAACCACTGGATTGTCTCCAGAGGATGAGAAAATTGACTAAATTTTTTAAAAATTTTAGGTAACTGAA
TTCAGTTACCTAAAATTTTTAAAAAATTTAGTCAATTTTCTCATCCTCTGGAGACAATCCAGTGGTTCTCATTACACACTATTACTTATTTAAACAAAGT[C/T]
CCATGTTTCTTAAACAAAAGGTTAAACAATTATTCTAACGTAAATATGAAATAAACTCATAATTCATAAAAAAAATTAAAAAAATCATATTAAAATTTCA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 96.10% | 3.80% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 93.40% | 6.50% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 78.90% | 21.10% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 91.30% | 8.50% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0106589855 | G -> A | LOC_Os01g12100.1 | upstream_gene_variant ; 1915.0bp to feature; MODIFIER | silent_mutation | Average:33.096; most accessible tissue: Minghui63 panicle, score: 56.842 | N | N | N | N |
| vg0106589855 | G -> A | LOC_Os01g12090.1 | downstream_gene_variant ; 2966.0bp to feature; MODIFIER | silent_mutation | Average:33.096; most accessible tissue: Minghui63 panicle, score: 56.842 | N | N | N | N |
| vg0106589855 | G -> A | LOC_Os01g12110.1 | downstream_gene_variant ; 1044.0bp to feature; MODIFIER | silent_mutation | Average:33.096; most accessible tissue: Minghui63 panicle, score: 56.842 | N | N | N | N |
| vg0106589855 | G -> A | LOC_Os01g12110.2 | downstream_gene_variant ; 1044.0bp to feature; MODIFIER | silent_mutation | Average:33.096; most accessible tissue: Minghui63 panicle, score: 56.842 | N | N | N | N |
| vg0106589855 | G -> A | LOC_Os01g12100-LOC_Os01g12110 | intergenic_region ; MODIFIER | silent_mutation | Average:33.096; most accessible tissue: Minghui63 panicle, score: 56.842 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0106589855 | NA | 3.06E-06 | mr1088 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106589855 | NA | 3.42E-06 | mr1310 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106589855 | 1.82E-19 | 4.83E-38 | mr1498 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106589855 | 2.89E-10 | 6.16E-27 | mr1769 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106589855 | 3.28E-07 | 3.28E-07 | mr1916 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106589855 | 2.12E-08 | 3.90E-15 | mr1925 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106589855 | 4.23E-15 | 3.01E-26 | mr1951 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106589855 | 5.74E-07 | 3.30E-13 | mr1310_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106589855 | 4.17E-11 | 4.10E-25 | mr1498_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106589855 | 3.56E-14 | 1.54E-33 | mr1769_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106589855 | 8.64E-10 | 5.79E-11 | mr1916_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106589855 | 8.69E-08 | 4.76E-13 | mr1925_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106589855 | 1.16E-09 | 6.18E-19 | mr1951_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |