\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0106589855:

Variant ID: vg0106589855 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 6589855
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGAAATTTTAATATGATTTTTTTAATTTTTTTTATGAATTATGAGTTTATTTCATATTTACGTTAGAATAATTGTTTAACCTTTTGTTTAAGAAACATGG[G/A]
ACTTTGTTTAAATAAGTAATAGTGTGTAATGAGAACCACTGGATTGTCTCCAGAGGATGAGAAAATTGACTAAATTTTTTAAAAATTTTAGGTAACTGAA

Reverse complement sequence

TTCAGTTACCTAAAATTTTTAAAAAATTTAGTCAATTTTCTCATCCTCTGGAGACAATCCAGTGGTTCTCATTACACACTATTACTTATTTAAACAAAGT[C/T]
CCATGTTTCTTAAACAAAAGGTTAAACAATTATTCTAACGTAAATATGAAATAAACTCATAATTCATAAAAAAAATTAAAAAAATCATATTAAAATTTCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 96.10% 3.80% 0.02% 0.00% NA
All Indica  2759 93.40% 6.50% 0.04% 0.00% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 78.90% 21.10% 0.00% 0.00% NA
Indica III  913 98.50% 1.50% 0.00% 0.00% NA
Indica Intermediate  786 91.30% 8.50% 0.13% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 98.90% 1.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0106589855 G -> A LOC_Os01g12100.1 upstream_gene_variant ; 1915.0bp to feature; MODIFIER silent_mutation Average:33.096; most accessible tissue: Minghui63 panicle, score: 56.842 N N N N
vg0106589855 G -> A LOC_Os01g12090.1 downstream_gene_variant ; 2966.0bp to feature; MODIFIER silent_mutation Average:33.096; most accessible tissue: Minghui63 panicle, score: 56.842 N N N N
vg0106589855 G -> A LOC_Os01g12110.1 downstream_gene_variant ; 1044.0bp to feature; MODIFIER silent_mutation Average:33.096; most accessible tissue: Minghui63 panicle, score: 56.842 N N N N
vg0106589855 G -> A LOC_Os01g12110.2 downstream_gene_variant ; 1044.0bp to feature; MODIFIER silent_mutation Average:33.096; most accessible tissue: Minghui63 panicle, score: 56.842 N N N N
vg0106589855 G -> A LOC_Os01g12100-LOC_Os01g12110 intergenic_region ; MODIFIER silent_mutation Average:33.096; most accessible tissue: Minghui63 panicle, score: 56.842 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0106589855 NA 3.06E-06 mr1088 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106589855 NA 3.42E-06 mr1310 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106589855 1.82E-19 4.83E-38 mr1498 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106589855 2.89E-10 6.16E-27 mr1769 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106589855 3.28E-07 3.28E-07 mr1916 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106589855 2.12E-08 3.90E-15 mr1925 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106589855 4.23E-15 3.01E-26 mr1951 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106589855 5.74E-07 3.30E-13 mr1310_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106589855 4.17E-11 4.10E-25 mr1498_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106589855 3.56E-14 1.54E-33 mr1769_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106589855 8.64E-10 5.79E-11 mr1916_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106589855 8.69E-08 4.76E-13 mr1925_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106589855 1.16E-09 6.18E-19 mr1951_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251