\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0106432168:

Variant ID: vg0106432168 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 6432168
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.70, G: 0.30, others allele: 0.00, population size: 105. )

Flanking Sequence (100 bp) in Reference Genome:


TTTATCAAACATTTGATGTGACAGCGTGAATTTTTTTTTAACTAAGTGGGACTAAAAAGAAGTTGTAGTACTAAGGGTGTGTTTGGATAATGGGAAATGG[A/G]
GGGTGGGATTGGGATTAGAAAATGAATGAAAGATTAGGATTAAATAAAAGAGGGAGAATGAATTGTTAGGATTTAAAGATGACTTTTGATGGATGGGAAA

Reverse complement sequence

TTTCCCATCCATCAAAAGTCATCTTTAAATCCTAACAATTCATTCTCCCTCTTTTATTTAATCCTAATCTTTCATTCATTTTCTAATCCCAATCCCACCC[T/C]
CCATTTCCCATTATCCAAACACACCCTTAGTACTACAACTTCTTTTTAGTCCCACTTAGTTAAAAAAAAATTCACGCTGTCACATCAAATGTTTGATAAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.10% 31.40% 0.44% 14.07% NA
All Indica  2759 43.10% 32.70% 0.58% 23.56% NA
All Japonica  1512 84.00% 15.50% 0.20% 0.26% NA
Aus  269 1.90% 97.40% 0.74% 0.00% NA
Indica I  595 5.40% 92.30% 0.34% 2.02% NA
Indica II  465 81.10% 2.20% 0.22% 16.56% NA
Indica III  913 44.00% 7.60% 0.11% 48.30% NA
Indica Intermediate  786 48.20% 35.00% 1.53% 15.27% NA
Temperate Japonica  767 98.40% 1.30% 0.26% 0.00% NA
Tropical Japonica  504 76.20% 23.20% 0.20% 0.40% NA
Japonica Intermediate  241 54.40% 44.80% 0.00% 0.83% NA
VI/Aromatic  96 32.30% 66.70% 0.00% 1.04% NA
Intermediate  90 65.60% 23.30% 0.00% 11.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0106432168 A -> G LOC_Os01g11880.1 upstream_gene_variant ; 168.0bp to feature; MODIFIER silent_mutation Average:89.825; most accessible tissue: Minghui63 panicle, score: 98.762 N N N N
vg0106432168 A -> G LOC_Os01g11870.1 downstream_gene_variant ; 3902.0bp to feature; MODIFIER silent_mutation Average:89.825; most accessible tissue: Minghui63 panicle, score: 98.762 N N N N
vg0106432168 A -> G LOC_Os01g11870-LOC_Os01g11880 intergenic_region ; MODIFIER silent_mutation Average:89.825; most accessible tissue: Minghui63 panicle, score: 98.762 N N N N
vg0106432168 A -> DEL N N silent_mutation Average:89.825; most accessible tissue: Minghui63 panicle, score: 98.762 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0106432168 A G 0.0 -0.01 -0.02 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0106432168 NA 2.47E-06 mr1496 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106432168 NA 1.42E-06 mr1531 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106432168 NA 4.16E-09 mr1565 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106432168 NA 5.52E-06 mr1629 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106432168 NA 1.24E-09 mr1662 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106432168 NA 4.88E-10 mr1904 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106432168 NA 9.85E-07 mr1904 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106432168 NA 1.55E-08 mr1942 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106432168 NA 4.85E-08 mr1024_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106432168 NA 3.98E-06 mr1201_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106432168 NA 6.20E-06 mr1232_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106432168 NA 9.85E-06 mr1233_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106432168 NA 8.43E-06 mr1265_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106432168 NA 2.82E-06 mr1528_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106432168 NA 1.14E-08 mr1557_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106432168 NA 7.66E-16 mr1565_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106432168 NA 6.82E-06 mr1592_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106432168 NA 5.02E-12 mr1598_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106432168 NA 1.61E-06 mr1619_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106432168 NA 7.98E-07 mr1636_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106432168 NA 1.53E-06 mr1641_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106432168 NA 7.52E-06 mr1659_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106432168 NA 8.41E-10 mr1715_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106432168 NA 1.64E-06 mr1767_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106432168 NA 8.77E-08 mr1838_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106432168 NA 2.82E-08 mr1949_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106432168 NA 3.18E-09 mr1962_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251