RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0106427492:

Variant ID: vg0106427492 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 6427492
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:

AATCGTGACTACCAGCGGTATGCTTTGTTGGAAGGTACAACATCTCAATATTTTGCTATTACTTTTGAAGAACCATTAACAAAATGTATGTGTAATCTTT[G/A]
TTAAAATGGATGCAGAAGTGAGAAACTCCTTGTTGAAAGAACCAACCCTGCATGACGCCATTAAGATTGTTGTGACCTATAGGAAGCAAGAGCTACTGCA

Reverse complement sequence

TGCAGTAGCTCTTGCTTCCTATAGGTCACAACAATCTTAATGGCGTCATGCAGGGTTGGTTCTTTCAACAAGGAGTTTCTCACTTCTGCATCCATTTTAA[C/T]
AAAGATTACACATACATTTTGTTAATGGTTCTTCAAAAGTAATAGCAAAATATTGAGATGTTGTACCTTCCAACAAAGCATACCGCTGGTAGTCACGATT

Allele Frequencies:

Search:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	90.50%	9.40%	0.08%	0.00%	NA
All Indica	2759	92.30%	7.70%	0.00%	0.00%	NA
All Japonica	1512	85.20%	14.70%	0.13%	0.00%	NA
Aus	269	97.80%	1.50%	0.74%	0.00%	NA
Indica I	595	89.90%	10.10%	0.00%	0.00%	NA
Indica II	465	99.80%	0.20%	0.00%	0.00%	NA
Indica III	913	98.50%	1.50%	0.00%	0.00%	NA
Indica Intermediate	786	82.40%	17.60%	0.00%	0.00%	NA
Temperate Japonica	767	98.60%	1.30%	0.13%	0.00%	NA
Tropical Japonica	504	78.60%	21.20%	0.20%	0.00%	NA
Japonica Intermediate	241	56.40%	43.60%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	95.60%	4.40%	0.00%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0106427492	G -> A	LOC_Os01g11880.1	upstream_gene_variant ; 4844.0bp to feature; MODIFIER	silent_mutation	Average:24.662; most accessible tissue: Zhenshan97 panicle, score: 39.652	N	N	N	N
vg0106427492	G -> A	LOC_Os01g11870.1	intron_variant ; MODIFIER	silent_mutation	Average:24.662; most accessible tissue: Zhenshan97 panicle, score: 39.652	N	N	N	N

Showing 1 to 2 of 2 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0106427492	NA	9.53E-06	mr1519_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106427492	NA	1.04E-08	mr1533_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106427492	NA	7.26E-06	mr1580_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106427492	NA	6.19E-07	mr1825_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106427492	NA	1.27E-06	mr1870_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106427492	NA	2.27E-07	mr1924_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106427492	NA	6.11E-08	mr1943_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106427492	NA	3.60E-06	mr1980_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 8 of 8 entries

Previous1Next

Search for Variation information by Variation ID:

Detailed information for vg0106427492:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact