\
| Variant ID: vg0106427492 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 6427492 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 259. )
AATCGTGACTACCAGCGGTATGCTTTGTTGGAAGGTACAACATCTCAATATTTTGCTATTACTTTTGAAGAACCATTAACAAAATGTATGTGTAATCTTT[G/A]
TTAAAATGGATGCAGAAGTGAGAAACTCCTTGTTGAAAGAACCAACCCTGCATGACGCCATTAAGATTGTTGTGACCTATAGGAAGCAAGAGCTACTGCA
TGCAGTAGCTCTTGCTTCCTATAGGTCACAACAATCTTAATGGCGTCATGCAGGGTTGGTTCTTTCAACAAGGAGTTTCTCACTTCTGCATCCATTTTAA[C/T]
AAAGATTACACATACATTTTGTTAATGGTTCTTCAAAAGTAATAGCAAAATATTGAGATGTTGTACCTTCCAACAAAGCATACCGCTGGTAGTCACGATT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 90.50% | 9.40% | 0.08% | 0.00% | NA |
| All Indica | 2759 | 92.30% | 7.70% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 85.20% | 14.70% | 0.13% | 0.00% | NA |
| Aus | 269 | 97.80% | 1.50% | 0.74% | 0.00% | NA |
| Indica I | 595 | 89.90% | 10.10% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 82.40% | 17.60% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 98.60% | 1.30% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 78.60% | 21.20% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 56.40% | 43.60% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 95.60% | 4.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0106427492 | G -> A | LOC_Os01g11880.1 | upstream_gene_variant ; 4844.0bp to feature; MODIFIER | silent_mutation | Average:24.662; most accessible tissue: Zhenshan97 panicle, score: 39.652 | N | N | N | N |
| vg0106427492 | G -> A | LOC_Os01g11870.1 | intron_variant ; MODIFIER | silent_mutation | Average:24.662; most accessible tissue: Zhenshan97 panicle, score: 39.652 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0106427492 | NA | 9.53E-06 | mr1519_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106427492 | NA | 1.04E-08 | mr1533_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106427492 | NA | 7.26E-06 | mr1580_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106427492 | NA | 6.19E-07 | mr1825_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106427492 | NA | 1.27E-06 | mr1870_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106427492 | NA | 2.27E-07 | mr1924_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106427492 | NA | 6.11E-08 | mr1943_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106427492 | NA | 3.60E-06 | mr1980_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |