\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0106366763:

Variant ID: vg0106366763 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 6366763
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.64, A: 0.36, others allele: 0.00, population size: 77. )

Flanking Sequence (100 bp) in Reference Genome:


GATAGCTCATCGTGATTAAGTAACAATTAATCACCTTTCCCATTGACCTCGACGTCCTCTTTTATCTACAGTAAATTCTTCACAAGGAGAAGAAAAAAAA[T/A]
AAAGAAAACCAGCTTCGAATCGATGTGCTAACCTGATCGATTGCTGACGACGCTGCAGGGTTCAGTGCCTCGTCGAGGCTCCGGGCGTGCTGCGGCGGCG

Reverse complement sequence

CGCCGCCGCAGCACGCCCGGAGCCTCGACGAGGCACTGAACCCTGCAGCGTCGTCAGCAATCGATCAGGTTAGCACATCGATTCGAAGCTGGTTTTCTTT[A/T]
TTTTTTTTCTTCTCCTTGTGAAGAATTTACTGTAGATAAAAGAGGACGTCGAGGTCAATGGGAAAGGTGATTAATTGTTACTTAATCACGATGAGCTATC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.60% 36.60% 0.49% 0.30% NA
All Indica  2759 45.30% 53.40% 0.80% 0.51% NA
All Japonica  1512 84.60% 15.40% 0.00% 0.00% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 4.20% 90.40% 3.53% 1.85% NA
Indica II  465 81.50% 18.50% 0.00% 0.00% NA
Indica III  913 48.30% 51.60% 0.11% 0.00% NA
Indica Intermediate  786 51.50% 48.10% 0.00% 0.38% NA
Temperate Japonica  767 98.40% 1.60% 0.00% 0.00% NA
Tropical Japonica  504 60.70% 39.30% 0.00% 0.00% NA
Japonica Intermediate  241 90.50% 9.50% 0.00% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 78.90% 20.00% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0106366763 T -> A LOC_Os01g11780.1 upstream_gene_variant ; 2656.0bp to feature; MODIFIER silent_mutation Average:85.611; most accessible tissue: Minghui63 root, score: 94.332 N N N N
vg0106366763 T -> A LOC_Os01g11750.1 downstream_gene_variant ; 3306.0bp to feature; MODIFIER silent_mutation Average:85.611; most accessible tissue: Minghui63 root, score: 94.332 N N N N
vg0106366763 T -> A LOC_Os01g11770.1 downstream_gene_variant ; 1275.0bp to feature; MODIFIER silent_mutation Average:85.611; most accessible tissue: Minghui63 root, score: 94.332 N N N N
vg0106366763 T -> A LOC_Os01g11760.1 intron_variant ; MODIFIER silent_mutation Average:85.611; most accessible tissue: Minghui63 root, score: 94.332 N N N N
vg0106366763 T -> DEL N N silent_mutation Average:85.611; most accessible tissue: Minghui63 root, score: 94.332 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0106366763 T A -0.01 -0.02 -0.02 -0.01 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0106366763 NA 7.08E-07 mr1498 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106366763 NA 1.26E-06 mr1662 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106366763 NA 7.72E-09 mr1942 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106366763 NA 1.82E-06 mr1063_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106366763 NA 7.52E-06 mr1161_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106366763 NA 9.65E-07 mr1183_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106366763 1.83E-06 NA mr1208_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106366763 NA 3.42E-06 mr1332_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106366763 NA 4.65E-06 mr1360_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106366763 NA 7.66E-06 mr1498_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106366763 NA 5.35E-06 mr1509_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106366763 NA 1.03E-11 mr1565_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106366763 NA 9.98E-11 mr1565_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106366763 NA 4.25E-06 mr1612_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106366763 NA 2.38E-11 mr1739_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106366763 NA 1.18E-09 mr1746_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106366763 NA 5.15E-06 mr1763_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106366763 NA 1.70E-16 mr1769_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106366763 NA 3.68E-06 mr1793_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106366763 NA 1.39E-08 mr1829_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106366763 NA 3.50E-09 mr1862_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106366763 NA 3.07E-06 mr1977_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251