\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0106354885:

Variant ID: vg0106354885 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 6354885
Reference Allele: TAlternative Allele: C,A
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGTAAGGTTGAAAATGGCATCAAAGTGAACAGTCCCTTTTAGCCCTCAGGATTTGTCCCAAAATATAACTTCTCCATCAACATTCTCTTCCCAACCAATC[T/C,A]
CAACTCTCCACGATTCGCTTTTCCCACCAACATCCATTACTTATTCAATCACAATCCTCCACCATTTACTTCTACCTAATTTCTTAATAACTGTGTCCAA

Reverse complement sequence

TTGGACACAGTTATTAAGAAATTAGGTAGAAGTAAATGGTGGAGGATTGTGATTGAATAAGTAATGGATGTTGGTGGGAAAAGCGAATCGTGGAGAGTTG[A/G,T]
GATTGGTTGGGAAGAGAATGTTGATGGAGAAGTTATATTTTGGGACAAATCCTGAGGGCTAAAAGGGACTGTTCACTTTGATGCCATTTTCAACCTTACC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 75.50% 24.10% 0.00% 0.40% A: 0.02%
All Indica  2759 97.40% 1.90% 0.00% 0.69% NA
All Japonica  1512 31.50% 68.40% 0.00% 0.00% A: 0.07%
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 98.30% 1.70% 0.00% 0.00% NA
Indica III  913 97.40% 0.70% 0.00% 1.97% NA
Indica Intermediate  786 95.00% 4.80% 0.00% 0.13% NA
Temperate Japonica  767 4.70% 95.30% 0.00% 0.00% NA
Tropical Japonica  504 62.30% 37.70% 0.00% 0.00% NA
Japonica Intermediate  241 52.70% 46.90% 0.00% 0.00% A: 0.41%
VI/Aromatic  96 69.80% 30.20% 0.00% 0.00% NA
Intermediate  90 74.40% 25.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0106354885 T -> A LOC_Os01g11740.1 intron_variant ; MODIFIER silent_mutation Average:26.643; most accessible tissue: Zhenshan97 panicle, score: 46.362 N N N N
vg0106354885 T -> DEL N N silent_mutation Average:26.643; most accessible tissue: Zhenshan97 panicle, score: 46.362 N N N N
vg0106354885 T -> C LOC_Os01g11740.1 intron_variant ; MODIFIER silent_mutation Average:26.643; most accessible tissue: Zhenshan97 panicle, score: 46.362 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0106354885 NA 9.65E-17 mr1308 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106354885 NA 6.01E-22 mr1584 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106354885 NA 4.86E-07 mr1584 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106354885 NA 1.81E-36 mr1784 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106354885 NA 6.20E-06 mr1063_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106354885 NA 4.67E-06 mr1072_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106354885 NA 8.77E-06 mr1075_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106354885 NA 3.27E-06 mr1129_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106354885 NA 7.55E-07 mr1248_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106354885 NA 1.43E-08 mr1251_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106354885 NA 3.21E-07 mr1252_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106354885 NA 1.51E-06 mr1295_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106354885 NA 1.14E-06 mr1423_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106354885 NA 1.54E-08 mr1435_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106354885 NA 1.79E-06 mr1498_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106354885 NA 3.65E-06 mr1509_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106354885 NA 6.49E-10 mr1580_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106354885 NA 4.13E-06 mr1723_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106354885 NA 7.31E-09 mr1741_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106354885 NA 3.58E-17 mr1746_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106354885 NA 1.95E-11 mr1746_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106354885 8.07E-07 4.16E-17 mr1769_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106354885 NA 6.58E-43 mr1771_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106354885 NA 1.97E-10 mr1771_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106354885 NA 3.64E-44 mr1784_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106354885 NA 3.98E-10 mr1784_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106354885 NA 1.16E-06 mr1785_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106354885 NA 4.18E-15 mr1800_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106354885 NA 1.54E-11 mr1844_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106354885 NA 1.22E-39 mr1862_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106354885 NA 1.18E-10 mr1862_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251