\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0106347718:

Variant ID: vg0106347718 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 6347718
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.01, others allele: 0.00, population size: 122. )

Flanking Sequence (100 bp) in Reference Genome:


CTTTACCCACACGACATTACTAACCTTGGTCACCTAGCCCGTGTGGATCAGACACGTCTGGTGACTTGGGGCTTTCACGACAAGGCATTTCGAAAGCCGA[C/T]
ACAGGTTCACCATATGCCAACGAGAGGGGTCCCATACCGACATCAGGTTAGGTCCTAGACCATACTGTGCCAGGAAGCCCGGGGGTTCTCCCCGGCACCA

Reverse complement sequence

TGGTGCCGGGGAGAACCCCCGGGCTTCCTGGCACAGTATGGTCTAGGACCTAACCTGATGTCGGTATGGGACCCCTCTCGTTGGCATATGGTGAACCTGT[G/A]
TCGGCTTTCGAAATGCCTTGTCGTGAAAGCCCCAAGTCACCAGACGTGTCTGATCCACACGGGCTAGGTGACCAAGGTTAGTAATGTCGTGTGGGTAAAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.10% 48.60% 0.34% 0.00% NA
All Indica  2759 18.70% 80.70% 0.58% 0.00% NA
All Japonica  1512 98.60% 1.40% 0.00% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 10.10% 89.90% 0.00% 0.00% NA
Indica II  465 22.80% 77.20% 0.00% 0.00% NA
Indica III  913 8.40% 89.90% 1.64% 0.00% NA
Indica Intermediate  786 34.70% 65.10% 0.13% 0.00% NA
Temperate Japonica  767 98.70% 1.30% 0.00% 0.00% NA
Tropical Japonica  504 98.60% 1.40% 0.00% 0.00% NA
Japonica Intermediate  241 98.30% 1.70% 0.00% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 52.20% 47.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0106347718 C -> T LOC_Os01g11740.1 upstream_gene_variant ; 4864.0bp to feature; MODIFIER silent_mutation Average:27.225; most accessible tissue: Minghui63 root, score: 40.262 N N N N
vg0106347718 C -> T LOC_Os01g11730.1 downstream_gene_variant ; 3373.0bp to feature; MODIFIER silent_mutation Average:27.225; most accessible tissue: Minghui63 root, score: 40.262 N N N N
vg0106347718 C -> T LOC_Os01g11730-LOC_Os01g11740 intergenic_region ; MODIFIER silent_mutation Average:27.225; most accessible tissue: Minghui63 root, score: 40.262 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0106347718 NA 6.22E-10 mr1191 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106347718 NA 2.57E-09 mr1457 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106347718 5.83E-07 5.56E-09 mr1498 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106347718 NA 3.69E-20 mr1598 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106347718 NA 2.80E-16 mr1916 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106347718 2.57E-06 NA mr1925 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106347718 1.23E-07 2.32E-07 mr1925 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106347718 NA 1.72E-21 mr1943 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106347718 6.76E-06 1.75E-10 mr1310_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106347718 NA 1.54E-08 mr1498_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106347718 NA 4.70E-11 mr1769_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106347718 NA 3.49E-06 mr1875_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106347718 NA 4.10E-22 mr1924_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106347718 NA 2.98E-06 mr1924_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106347718 1.79E-06 6.79E-34 mr1943_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106347718 7.67E-06 1.46E-10 mr1943_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251