\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0106328375:

Variant ID: vg0106328375 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 6328375
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.01, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:


ATTGTACTCTTACTACAGTGTATTTTATTATAGAAAGAGTTAAAGAAAAACAAGTAATACGTCATACCATTTTGTCTTGTGTAGCATCATTAACATATCT[G/A]
CCATCTTTTGTCTTATGGCATTCATCAAAGAAGGTTGCTCTGTCCACCTCCACTCCATCATGTTCCTGCAGATTATACATGTCAAGTGCATGAGAAATAG

Reverse complement sequence

CTATTTCTCATGCACTTGACATGTATAATCTGCAGGAACATGATGGAGTGGAGGTGGACAGAGCAACCTTCTTTGATGAATGCCATAAGACAAAAGATGG[C/T]
AGATATGTTAATGATGCTACACAAGACAAAATGGTATGACGTATTACTTGTTTTTCTTTAACTCTTTCTATAATAAAATACACTGTAGTAAGAGTACAAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.90% 45.60% 0.68% 1.80% NA
All Indica  2759 19.90% 76.00% 1.05% 3.04% NA
All Japonica  1512 98.70% 1.10% 0.13% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 11.30% 87.20% 0.67% 0.84% NA
Indica II  465 22.80% 75.90% 1.08% 0.22% NA
Indica III  913 10.30% 81.30% 1.31% 7.12% NA
Indica Intermediate  786 35.80% 61.60% 1.02% 1.65% NA
Temperate Japonica  767 98.60% 1.30% 0.13% 0.00% NA
Tropical Japonica  504 99.20% 0.80% 0.00% 0.00% NA
Japonica Intermediate  241 98.30% 1.20% 0.41% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 55.60% 42.20% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0106328375 G -> A LOC_Os01g11720.1 synonymous_variant ; p.Gly254Gly; LOW synonymous_codon Average:15.759; most accessible tissue: Minghui63 root, score: 23.574 N N N N
vg0106328375 G -> DEL LOC_Os01g11720.1 N frameshift_variant Average:15.759; most accessible tissue: Minghui63 root, score: 23.574 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0106328375 NA 1.39E-10 mr1191 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106328375 3.45E-07 NA mr1207 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106328375 2.04E-06 1.60E-06 mr1207 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106328375 NA 1.27E-09 mr1457 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106328375 8.27E-07 NA mr1498 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106328375 4.71E-09 9.43E-11 mr1498 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106328375 NA 4.73E-22 mr1598 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106328375 NA 9.60E-09 mr1644 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106328375 NA 7.77E-07 mr1756 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106328375 2.78E-07 1.67E-11 mr1769 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106328375 NA 8.33E-18 mr1916 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106328375 3.53E-06 9.76E-07 mr1925 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106328375 7.39E-06 4.65E-27 mr1943 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106328375 NA 1.93E-06 mr1943 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106328375 2.27E-07 NA mr1951 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106328375 4.28E-07 5.93E-12 mr1310_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106328375 1.35E-06 NA mr1498_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106328375 5.91E-08 4.40E-11 mr1498_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106328375 3.20E-08 4.77E-15 mr1769_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106328375 NA 6.99E-24 mr1924_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106328375 NA 9.18E-07 mr1924_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106328375 NA 4.03E-06 mr1925_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106328375 1.56E-07 2.40E-36 mr1943_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106328375 1.21E-06 1.73E-11 mr1943_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106328375 NA 2.30E-06 mr1951_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251