\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0106309143:

Variant ID: vg0106309143 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 6309143
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATTTCCTAATTGTATTTCTATGTGGACTCTATACTCTACTTCTAATATTCCTTATTTTTAATTCCGAATTTCAGTTATTTCCTAGTTGTATTCCTATATG[G/T]
ACTCTAGTCTCCTCTTCTAATATTTTTTATTTTTTAATTCCGAATTTCAACTATTTCTAAATTGTATTTCTATATGGACTCTAGTCTCTTCTTCTAATAT

Reverse complement sequence

ATATTAGAAGAAGAGACTAGAGTCCATATAGAAATACAATTTAGAAATAGTTGAAATTCGGAATTAAAAAATAAAAAATATTAGAAGAGGAGACTAGAGT[C/A]
CATATAGGAATACAACTAGGAAATAACTGAAATTCGGAATTAAAAATAAGGAATATTAGAAGTAGAGTATAGAGTCCACATAGAAATACAATTAGGAAAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 83.10% 12.90% 3.62% 0.38% NA
All Indica  2759 91.10% 5.90% 2.72% 0.25% NA
All Japonica  1512 85.40% 13.40% 1.19% 0.00% NA
Aus  269 3.70% 67.30% 24.91% 4.09% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 79.40% 11.40% 8.17% 1.08% NA
Indica III  913 92.60% 5.30% 2.19% 0.00% NA
Indica Intermediate  786 89.60% 8.00% 2.16% 0.25% NA
Temperate Japonica  767 98.30% 1.60% 0.13% 0.00% NA
Tropical Japonica  504 82.30% 16.50% 1.19% 0.00% NA
Japonica Intermediate  241 51.00% 44.40% 4.56% 0.00% NA
VI/Aromatic  96 39.60% 52.10% 8.33% 0.00% NA
Intermediate  90 82.20% 14.40% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0106309143 G -> T LOC_Os01g11700.1 downstream_gene_variant ; 2535.0bp to feature; MODIFIER silent_mutation Average:19.571; most accessible tissue: Minghui63 panicle, score: 50.413 N N N N
vg0106309143 G -> T LOC_Os01g11704.1 downstream_gene_variant ; 2791.0bp to feature; MODIFIER silent_mutation Average:19.571; most accessible tissue: Minghui63 panicle, score: 50.413 N N N N
vg0106309143 G -> T LOC_Os01g11700.2 downstream_gene_variant ; 2535.0bp to feature; MODIFIER silent_mutation Average:19.571; most accessible tissue: Minghui63 panicle, score: 50.413 N N N N
vg0106309143 G -> T LOC_Os01g11700-LOC_Os01g11704 intergenic_region ; MODIFIER silent_mutation Average:19.571; most accessible tissue: Minghui63 panicle, score: 50.413 N N N N
vg0106309143 G -> DEL N N silent_mutation Average:19.571; most accessible tissue: Minghui63 panicle, score: 50.413 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0106309143 NA 1.69E-06 mr1117 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106309143 NA 1.86E-07 mr1118 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106309143 NA 9.94E-06 mr1119 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106309143 NA 1.60E-06 mr1188 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106309143 NA 2.46E-08 mr1207 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106309143 NA 3.47E-06 mr1240 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106309143 NA 6.15E-06 mr1242 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106309143 9.99E-14 3.41E-29 mr1498 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106309143 8.48E-06 NA mr1566 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106309143 NA 6.18E-07 mr1693 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106309143 2.57E-06 NA mr1769 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106309143 1.33E-09 4.92E-24 mr1769 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106309143 3.05E-06 3.05E-06 mr1916 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106309143 1.20E-06 1.33E-12 mr1925 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106309143 4.72E-07 NA mr1951 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106309143 8.95E-12 1.04E-21 mr1951 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106309143 NA 2.26E-06 mr1117_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106309143 NA 3.48E-06 mr1119_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106309143 NA 1.50E-06 mr1188_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106309143 NA 5.45E-06 mr1240_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106309143 NA 1.83E-11 mr1310_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106309143 NA 4.61E-07 mr1496_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106309143 7.91E-07 NA mr1498_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106309143 2.50E-09 1.16E-21 mr1498_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106309143 1.81E-07 NA mr1769_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106309143 1.07E-09 6.69E-26 mr1769_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106309143 NA 5.49E-06 mr1861_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106309143 1.79E-06 1.05E-07 mr1916_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106309143 NA 5.89E-11 mr1925_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106309143 7.12E-08 6.89E-16 mr1951_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251