\
| Variant ID: vg0106301158 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 6301158 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
TCTTTTTTTCCCTCCATCTGAGTATAATGGCACCCTTTTTTCCCTCCAGAAACAGAGCAACAAACGGCGGCGCACGGCAATGAGGATGTTTGTGGGCCAT[T/C]
TTCATTGGCATGGGCTGACCGCGAGCCCGTTTGACCGCCTTATTCGTTGCGCTCGTGCGACCGCCGCCGCCGCTGTGGAAGCCGTCGTTGTTGAGGACGG
CCGTCCTCAACAACGACGGCTTCCACAGCGGCGGCGGCGGTCGCACGAGCGCAACGAATAAGGCGGTCAAACGGGCTCGCGGTCAGCCCATGCCAATGAA[A/G]
ATGGCCCACAAACATCCTCATTGCCGTGCGCCGCCGTTTGTTGCTCTGTTTCTGGAGGGAAAAAAGGGTGCCATTATACTCAGATGGAGGGAAAAAAAGA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 96.10% | 1.60% | 1.95% | 0.34% | NA |
| All Indica | 2759 | 99.30% | 0.10% | 0.07% | 0.58% | NA |
| All Japonica | 1512 | 89.20% | 5.00% | 5.89% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.40% | 0.00% | 0.00% | 1.64% | NA |
| Indica Intermediate | 786 | 99.60% | 0.00% | 0.25% | 0.13% | NA |
| Temperate Japonica | 767 | 79.50% | 9.80% | 10.69% | 0.00% | NA |
| Tropical Japonica | 504 | 99.60% | 0.00% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 97.90% | 0.00% | 2.07% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 98.90% | 0.00% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0106301158 | T -> DEL | N | N | silent_mutation | Average:52.52; most accessible tissue: Minghui63 young leaf, score: 75.006 | N | N | N | N |
| vg0106301158 | T -> C | LOC_Os01g11700.1 | upstream_gene_variant ; 3644.0bp to feature; MODIFIER | silent_mutation | Average:52.52; most accessible tissue: Minghui63 young leaf, score: 75.006 | N | N | N | N |
| vg0106301158 | T -> C | LOC_Os01g11700.2 | upstream_gene_variant ; 3644.0bp to feature; MODIFIER | silent_mutation | Average:52.52; most accessible tissue: Minghui63 young leaf, score: 75.006 | N | N | N | N |
| vg0106301158 | T -> C | LOC_Os01g11670.1 | downstream_gene_variant ; 3482.0bp to feature; MODIFIER | silent_mutation | Average:52.52; most accessible tissue: Minghui63 young leaf, score: 75.006 | N | N | N | N |
| vg0106301158 | T -> C | LOC_Os01g11690.1 | downstream_gene_variant ; 2404.0bp to feature; MODIFIER | silent_mutation | Average:52.52; most accessible tissue: Minghui63 young leaf, score: 75.006 | N | N | N | N |
| vg0106301158 | T -> C | LOC_Os01g11680.1 | intron_variant ; MODIFIER | silent_mutation | Average:52.52; most accessible tissue: Minghui63 young leaf, score: 75.006 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0106301158 | 8.40E-06 | NA | mr1296 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106301158 | 5.01E-08 | 5.01E-08 | mr1371_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106301158 | 3.89E-06 | 3.89E-06 | mr1445_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |