\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0106295051:

Variant ID: vg0106295051 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 6295051
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.90, T: 0.09, others allele: 0.00, population size: 218. )

Flanking Sequence (100 bp) in Reference Genome:


GGTCGGAAAAACCCTATACCATTTTCATTTTTGTATTTTTTTTCTCGAAAACTGAATTGGAACGATAGATCTGAAAACGGTAACGATATCAGTAATATCG[G/T]
TATATCGGAAATGGGACCGTCGGAACGGAATATATCGATATTGGTTGGAAATCGAAAATTCATGTTGGTATCAGAGGAGTGTGACATTGTACACATTTAA

Reverse complement sequence

TTAAATGTGTACAATGTCACACTCCTCTGATACCAACATGAATTTTCGATTTCCAACCAATATCGATATATTCCGTTCCGACGGTCCCATTTCCGATATA[C/A]
CGATATTACTGATATCGTTACCGTTTTCAGATCTATCGTTCCAATTCAGTTTTCGAGAAAAAAAATACAAAAATGAAAATGGTATAGGGTTTTTCCGACC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 73.00% 26.50% 0.13% 0.40% NA
All Indica  2759 83.70% 15.50% 0.11% 0.69% NA
All Japonica  1512 68.30% 31.50% 0.13% 0.00% NA
Aus  269 0.40% 99.60% 0.00% 0.00% NA
Indica I  595 89.70% 10.10% 0.17% 0.00% NA
Indica II  465 78.90% 21.10% 0.00% 0.00% NA
Indica III  913 92.40% 5.60% 0.00% 1.97% NA
Indica Intermediate  786 71.80% 27.90% 0.25% 0.13% NA
Temperate Japonica  767 96.50% 3.50% 0.00% 0.00% NA
Tropical Japonica  504 38.10% 61.90% 0.00% 0.00% NA
Japonica Intermediate  241 41.90% 57.30% 0.83% 0.00% NA
VI/Aromatic  96 39.60% 60.40% 0.00% 0.00% NA
Intermediate  90 75.60% 23.30% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0106295051 G -> T LOC_Os01g11670.1 upstream_gene_variant ; 940.0bp to feature; MODIFIER silent_mutation Average:36.17; most accessible tissue: Zhenshan97 panicle, score: 68.538 N N N N
vg0106295051 G -> T LOC_Os01g11660.1 downstream_gene_variant ; 2748.0bp to feature; MODIFIER silent_mutation Average:36.17; most accessible tissue: Zhenshan97 panicle, score: 68.538 N N N N
vg0106295051 G -> T LOC_Os01g11680.1 downstream_gene_variant ; 3893.0bp to feature; MODIFIER silent_mutation Average:36.17; most accessible tissue: Zhenshan97 panicle, score: 68.538 N N N N
vg0106295051 G -> T LOC_Os01g11660-LOC_Os01g11670 intergenic_region ; MODIFIER silent_mutation Average:36.17; most accessible tissue: Zhenshan97 panicle, score: 68.538 N N N N
vg0106295051 G -> DEL N N silent_mutation Average:36.17; most accessible tissue: Zhenshan97 panicle, score: 68.538 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0106295051 NA 3.78E-06 mr1191 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106295051 NA 3.85E-09 mr1207 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106295051 9.30E-06 NA mr1498 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106295051 NA 2.35E-06 mr1644 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106295051 2.05E-06 NA mr1769 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106295051 NA 5.57E-09 mr1769 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106295051 NA 8.46E-08 mr1063_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106295051 NA 2.27E-06 mr1161_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106295051 NA 2.90E-09 mr1180_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106295051 NA 2.03E-09 mr1183_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106295051 NA 2.39E-06 mr1236_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106295051 NA 5.45E-07 mr1295_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106295051 2.13E-06 2.45E-11 mr1310_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106295051 1.29E-06 NA mr1498_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106295051 8.98E-07 8.61E-10 mr1498_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106295051 NA 8.37E-09 mr1543_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106295051 NA 8.07E-06 mr1723_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106295051 NA 2.93E-08 mr1746_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106295051 1.46E-09 6.60E-16 mr1769_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106295051 9.42E-07 4.60E-12 mr1769_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106295051 NA 6.62E-15 mr1769_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106295051 NA 1.14E-06 mr1792_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106295051 NA 6.96E-06 mr1793_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106295051 NA 5.81E-08 mr1794_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106295051 NA 9.42E-08 mr1808_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106295051 8.06E-06 1.18E-08 mr1924_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106295051 NA 2.39E-06 mr1925_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106295051 7.45E-07 1.08E-11 mr1943_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106295051 2.65E-06 NA mr1951_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106295051 NA 3.58E-07 mr1951_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251