Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0106294847:

Variant ID: vg0106294847 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 6294847
Reference Allele: G	Alternative Allele: T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, T: 0.03, others allele: 0.00, population size: 120. )

Flanking Sequence (100 bp) in Reference Genome:

TTCGATTCTTATTCGTATTCGAGATAGTCCGTATTTGTTTCCGTATTCGAGCTATCCGTATTCGTTTCCGTATCCGGCAAAAAATATGAAAACGAATATG[G/T]
TATGAGCATTATCCGTCCATATCTGCTCCGTTTTCATCCCTAGGTTCGACTGACCAAACCAGCCACCAAAAAAATTGCAGCAGTTGACACTAGGGATGAA

Reverse complement sequence

TTCATCCCTAGTGTCAACTGCTGCAATTTTTTTGGTGGCTGGTTTGGTCAGTCGAACCTAGGGATGAAAACGGAGCAGATATGGACGGATAATGCTCATA[C/A]
CATATTCGTTTTCATATTTTTTGCCGGATACGGAAACGAATACGGATAGCTCGAATACGGAAACAAATACGGACTATCTCGAATACGAATAAGAATCGAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	73.00%	26.40%	0.28%	0.30%	NA
All Indica	2759	83.70%	15.50%	0.33%	0.51%	NA
All Japonica	1512	68.50%	31.40%	0.07%	0.00%	NA
Aus	269	1.10%	98.90%	0.00%	0.00%	NA
Indica I	595	89.70%	9.90%	0.34%	0.00%	NA
Indica II	465	78.70%	20.90%	0.43%	0.00%	NA
Indica III	913	92.60%	5.70%	0.33%	1.42%	NA
Indica Intermediate	786	71.80%	27.90%	0.25%	0.13%	NA
Temperate Japonica	767	96.60%	3.40%	0.00%	0.00%	NA
Tropical Japonica	504	38.30%	61.70%	0.00%	0.00%	NA
Japonica Intermediate	241	42.30%	57.30%	0.41%	0.00%	NA
VI/Aromatic	96	38.50%	60.40%	1.04%	0.00%	NA
Intermediate	90	74.40%	23.30%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0106294847	G -> T	LOC_Os01g11670.1	upstream_gene_variant ; 1144.0bp to feature; MODIFIER	silent_mutation	Average:29.303; most accessible tissue: Zhenshan97 panicle, score: 61.671	N	N	N	N
vg0106294847	G -> T	LOC_Os01g11660.1	downstream_gene_variant ; 2544.0bp to feature; MODIFIER	silent_mutation	Average:29.303; most accessible tissue: Zhenshan97 panicle, score: 61.671	N	N	N	N
vg0106294847	G -> T	LOC_Os01g11680.1	downstream_gene_variant ; 4097.0bp to feature; MODIFIER	silent_mutation	Average:29.303; most accessible tissue: Zhenshan97 panicle, score: 61.671	N	N	N	N
vg0106294847	G -> T	LOC_Os01g11660-LOC_Os01g11670	intergenic_region ; MODIFIER	silent_mutation	Average:29.303; most accessible tissue: Zhenshan97 panicle, score: 61.671	N	N	N	N
vg0106294847	G -> DEL	N	N	silent_mutation	Average:29.303; most accessible tissue: Zhenshan97 panicle, score: 61.671	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0106294847	NA	6.42E-06	mr1191	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106294847	NA	5.04E-08	mr1207	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106294847	NA	3.02E-07	mr1584	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106294847	NA	3.80E-06	mr1644	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106294847	NA	1.33E-07	mr1063_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106294847	NA	5.09E-06	mr1161_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106294847	NA	9.71E-09	mr1180_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106294847	NA	1.08E-08	mr1183_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106294847	NA	4.19E-06	mr1236_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106294847	NA	3.13E-07	mr1295_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106294847	4.86E-11	1.86E-15	mr1310_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106294847	NA	1.54E-07	mr1498_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106294847	NA	2.45E-07	mr1502_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106294847	NA	1.26E-09	mr1543_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106294847	3.12E-06	1.94E-13	mr1769_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106294847	NA	8.54E-10	mr1769_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106294847	NA	3.81E-13	mr1769_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106294847	NA	8.76E-06	mr1793_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106294847	NA	1.26E-07	mr1794_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106294847	NA	2.03E-08	mr1808_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106294847	NA	2.51E-06	mr1825_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106294847	6.73E-06	8.23E-09	mr1924_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106294847	6.27E-07	3.85E-12	mr1943_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251