\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0106294847:

Variant ID: vg0106294847 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 6294847
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, T: 0.03, others allele: 0.00, population size: 120. )

Flanking Sequence (100 bp) in Reference Genome:


TTCGATTCTTATTCGTATTCGAGATAGTCCGTATTTGTTTCCGTATTCGAGCTATCCGTATTCGTTTCCGTATCCGGCAAAAAATATGAAAACGAATATG[G/T]
TATGAGCATTATCCGTCCATATCTGCTCCGTTTTCATCCCTAGGTTCGACTGACCAAACCAGCCACCAAAAAAATTGCAGCAGTTGACACTAGGGATGAA

Reverse complement sequence

TTCATCCCTAGTGTCAACTGCTGCAATTTTTTTGGTGGCTGGTTTGGTCAGTCGAACCTAGGGATGAAAACGGAGCAGATATGGACGGATAATGCTCATA[C/A]
CATATTCGTTTTCATATTTTTTGCCGGATACGGAAACGAATACGGATAGCTCGAATACGGAAACAAATACGGACTATCTCGAATACGAATAAGAATCGAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 73.00% 26.40% 0.28% 0.30% NA
All Indica  2759 83.70% 15.50% 0.33% 0.51% NA
All Japonica  1512 68.50% 31.40% 0.07% 0.00% NA
Aus  269 1.10% 98.90% 0.00% 0.00% NA
Indica I  595 89.70% 9.90% 0.34% 0.00% NA
Indica II  465 78.70% 20.90% 0.43% 0.00% NA
Indica III  913 92.60% 5.70% 0.33% 1.42% NA
Indica Intermediate  786 71.80% 27.90% 0.25% 0.13% NA
Temperate Japonica  767 96.60% 3.40% 0.00% 0.00% NA
Tropical Japonica  504 38.30% 61.70% 0.00% 0.00% NA
Japonica Intermediate  241 42.30% 57.30% 0.41% 0.00% NA
VI/Aromatic  96 38.50% 60.40% 1.04% 0.00% NA
Intermediate  90 74.40% 23.30% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0106294847 G -> T LOC_Os01g11670.1 upstream_gene_variant ; 1144.0bp to feature; MODIFIER silent_mutation Average:29.303; most accessible tissue: Zhenshan97 panicle, score: 61.671 N N N N
vg0106294847 G -> T LOC_Os01g11660.1 downstream_gene_variant ; 2544.0bp to feature; MODIFIER silent_mutation Average:29.303; most accessible tissue: Zhenshan97 panicle, score: 61.671 N N N N
vg0106294847 G -> T LOC_Os01g11680.1 downstream_gene_variant ; 4097.0bp to feature; MODIFIER silent_mutation Average:29.303; most accessible tissue: Zhenshan97 panicle, score: 61.671 N N N N
vg0106294847 G -> T LOC_Os01g11660-LOC_Os01g11670 intergenic_region ; MODIFIER silent_mutation Average:29.303; most accessible tissue: Zhenshan97 panicle, score: 61.671 N N N N
vg0106294847 G -> DEL N N silent_mutation Average:29.303; most accessible tissue: Zhenshan97 panicle, score: 61.671 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0106294847 NA 6.42E-06 mr1191 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106294847 NA 5.04E-08 mr1207 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106294847 NA 3.02E-07 mr1584 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106294847 NA 3.80E-06 mr1644 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106294847 NA 1.33E-07 mr1063_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106294847 NA 5.09E-06 mr1161_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106294847 NA 9.71E-09 mr1180_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106294847 NA 1.08E-08 mr1183_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106294847 NA 4.19E-06 mr1236_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106294847 NA 3.13E-07 mr1295_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106294847 4.86E-11 1.86E-15 mr1310_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106294847 NA 1.54E-07 mr1498_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106294847 NA 2.45E-07 mr1502_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106294847 NA 1.26E-09 mr1543_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106294847 3.12E-06 1.94E-13 mr1769_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106294847 NA 8.54E-10 mr1769_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106294847 NA 3.81E-13 mr1769_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106294847 NA 8.76E-06 mr1793_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106294847 NA 1.26E-07 mr1794_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106294847 NA 2.03E-08 mr1808_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106294847 NA 2.51E-06 mr1825_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106294847 6.73E-06 8.23E-09 mr1924_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106294847 6.27E-07 3.85E-12 mr1943_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251