\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0106294787:

Variant ID: vg0106294787 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 6294787
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAGTTGAATTGGTTTTCGTGTTCCGAGAAAAATTTGTTTCCGTATTCGTGTCCGATCATATTCGATTCTTATTCGTATTCGAGATAGTCCGTATTTGTTT[C/T]
CGTATTCGAGCTATCCGTATTCGTTTCCGTATCCGGCAAAAAATATGAAAACGAATATGGTATGAGCATTATCCGTCCATATCTGCTCCGTTTTCATCCC

Reverse complement sequence

GGGATGAAAACGGAGCAGATATGGACGGATAATGCTCATACCATATTCGTTTTCATATTTTTTGCCGGATACGGAAACGAATACGGATAGCTCGAATACG[G/A]
AAACAAATACGGACTATCTCGAATACGAATAAGAATCGAATATGATCGGACACGAATACGGAAACAAATTTTTCTCGGAACACGAAAACCAATTCAACTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.20% 15.50% 0.04% 0.30% NA
All Indica  2759 92.30% 7.10% 0.07% 0.51% NA
All Japonica  1512 86.70% 13.30% 0.00% 0.00% NA
Aus  269 1.90% 98.10% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 79.40% 20.60% 0.00% 0.00% NA
Indica III  913 94.60% 3.80% 0.11% 1.42% NA
Indica Intermediate  786 91.50% 8.30% 0.13% 0.13% NA
Temperate Japonica  767 98.30% 1.70% 0.00% 0.00% NA
Tropical Japonica  504 83.30% 16.70% 0.00% 0.00% NA
Japonica Intermediate  241 56.80% 43.20% 0.00% 0.00% NA
VI/Aromatic  96 39.60% 60.40% 0.00% 0.00% NA
Intermediate  90 84.40% 15.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0106294787 C -> T LOC_Os01g11670.1 upstream_gene_variant ; 1204.0bp to feature; MODIFIER silent_mutation Average:27.582; most accessible tissue: Zhenshan97 panicle, score: 59.59 N N N N
vg0106294787 C -> T LOC_Os01g11660.1 downstream_gene_variant ; 2484.0bp to feature; MODIFIER silent_mutation Average:27.582; most accessible tissue: Zhenshan97 panicle, score: 59.59 N N N N
vg0106294787 C -> T LOC_Os01g11680.1 downstream_gene_variant ; 4157.0bp to feature; MODIFIER silent_mutation Average:27.582; most accessible tissue: Zhenshan97 panicle, score: 59.59 N N N N
vg0106294787 C -> T LOC_Os01g11660-LOC_Os01g11670 intergenic_region ; MODIFIER silent_mutation Average:27.582; most accessible tissue: Zhenshan97 panicle, score: 59.59 N N N N
vg0106294787 C -> DEL N N silent_mutation Average:27.582; most accessible tissue: Zhenshan97 panicle, score: 59.59 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0106294787 3.94E-10 1.18E-25 mr1498 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106294787 9.72E-07 2.82E-22 mr1769 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106294787 1.39E-06 3.02E-12 mr1925 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106294787 9.02E-06 NA mr1951 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106294787 1.26E-08 3.59E-18 mr1951 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106294787 1.42E-14 5.58E-20 mr1310_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106294787 9.48E-08 NA mr1498_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106294787 4.00E-13 2.82E-24 mr1498_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106294787 5.42E-09 NA mr1769_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106294787 9.86E-13 1.26E-29 mr1769_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106294787 1.37E-09 2.13E-13 mr1925_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106294787 4.55E-06 NA mr1951_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106294787 1.32E-09 1.76E-17 mr1951_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251