Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0106294787:

Variant ID: vg0106294787 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 6294787
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AAGTTGAATTGGTTTTCGTGTTCCGAGAAAAATTTGTTTCCGTATTCGTGTCCGATCATATTCGATTCTTATTCGTATTCGAGATAGTCCGTATTTGTTT[C/T]
CGTATTCGAGCTATCCGTATTCGTTTCCGTATCCGGCAAAAAATATGAAAACGAATATGGTATGAGCATTATCCGTCCATATCTGCTCCGTTTTCATCCC

Reverse complement sequence

GGGATGAAAACGGAGCAGATATGGACGGATAATGCTCATACCATATTCGTTTTCATATTTTTTGCCGGATACGGAAACGAATACGGATAGCTCGAATACG[G/A]
AAACAAATACGGACTATCTCGAATACGAATAAGAATCGAATATGATCGGACACGAATACGGAAACAAATTTTTCTCGGAACACGAAAACCAATTCAACTT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	84.20%	15.50%	0.04%	0.30%	NA
All Indica	2759	92.30%	7.10%	0.07%	0.51%	NA
All Japonica	1512	86.70%	13.30%	0.00%	0.00%	NA
Aus	269	1.90%	98.10%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	79.40%	20.60%	0.00%	0.00%	NA
Indica III	913	94.60%	3.80%	0.11%	1.42%	NA
Indica Intermediate	786	91.50%	8.30%	0.13%	0.13%	NA
Temperate Japonica	767	98.30%	1.70%	0.00%	0.00%	NA
Tropical Japonica	504	83.30%	16.70%	0.00%	0.00%	NA
Japonica Intermediate	241	56.80%	43.20%	0.00%	0.00%	NA
VI/Aromatic	96	39.60%	60.40%	0.00%	0.00%	NA
Intermediate	90	84.40%	15.60%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0106294787	C -> T	LOC_Os01g11670.1	upstream_gene_variant ; 1204.0bp to feature; MODIFIER	silent_mutation	Average:27.582; most accessible tissue: Zhenshan97 panicle, score: 59.59	N	N	N	N
vg0106294787	C -> T	LOC_Os01g11660.1	downstream_gene_variant ; 2484.0bp to feature; MODIFIER	silent_mutation	Average:27.582; most accessible tissue: Zhenshan97 panicle, score: 59.59	N	N	N	N
vg0106294787	C -> T	LOC_Os01g11680.1	downstream_gene_variant ; 4157.0bp to feature; MODIFIER	silent_mutation	Average:27.582; most accessible tissue: Zhenshan97 panicle, score: 59.59	N	N	N	N
vg0106294787	C -> T	LOC_Os01g11660-LOC_Os01g11670	intergenic_region ; MODIFIER	silent_mutation	Average:27.582; most accessible tissue: Zhenshan97 panicle, score: 59.59	N	N	N	N
vg0106294787	C -> DEL	N	N	silent_mutation	Average:27.582; most accessible tissue: Zhenshan97 panicle, score: 59.59	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0106294787	3.94E-10	1.18E-25	mr1498	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106294787	9.72E-07	2.82E-22	mr1769	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106294787	1.39E-06	3.02E-12	mr1925	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106294787	9.02E-06	NA	mr1951	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106294787	1.26E-08	3.59E-18	mr1951	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106294787	1.42E-14	5.58E-20	mr1310_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106294787	9.48E-08	NA	mr1498_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106294787	4.00E-13	2.82E-24	mr1498_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106294787	5.42E-09	NA	mr1769_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106294787	9.86E-13	1.26E-29	mr1769_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106294787	1.37E-09	2.13E-13	mr1925_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106294787	4.55E-06	NA	mr1951_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106294787	1.32E-09	1.76E-17	mr1951_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251