\
| Variant ID: vg0106294787 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 6294787 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
AAGTTGAATTGGTTTTCGTGTTCCGAGAAAAATTTGTTTCCGTATTCGTGTCCGATCATATTCGATTCTTATTCGTATTCGAGATAGTCCGTATTTGTTT[C/T]
CGTATTCGAGCTATCCGTATTCGTTTCCGTATCCGGCAAAAAATATGAAAACGAATATGGTATGAGCATTATCCGTCCATATCTGCTCCGTTTTCATCCC
GGGATGAAAACGGAGCAGATATGGACGGATAATGCTCATACCATATTCGTTTTCATATTTTTTGCCGGATACGGAAACGAATACGGATAGCTCGAATACG[G/A]
AAACAAATACGGACTATCTCGAATACGAATAAGAATCGAATATGATCGGACACGAATACGGAAACAAATTTTTCTCGGAACACGAAAACCAATTCAACTT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 84.20% | 15.50% | 0.04% | 0.30% | NA |
| All Indica | 2759 | 92.30% | 7.10% | 0.07% | 0.51% | NA |
| All Japonica | 1512 | 86.70% | 13.30% | 0.00% | 0.00% | NA |
| Aus | 269 | 1.90% | 98.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 79.40% | 20.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 94.60% | 3.80% | 0.11% | 1.42% | NA |
| Indica Intermediate | 786 | 91.50% | 8.30% | 0.13% | 0.13% | NA |
| Temperate Japonica | 767 | 98.30% | 1.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 83.30% | 16.70% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 56.80% | 43.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 39.60% | 60.40% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 84.40% | 15.60% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0106294787 | C -> T | LOC_Os01g11670.1 | upstream_gene_variant ; 1204.0bp to feature; MODIFIER | silent_mutation | Average:27.582; most accessible tissue: Zhenshan97 panicle, score: 59.59 | N | N | N | N |
| vg0106294787 | C -> T | LOC_Os01g11660.1 | downstream_gene_variant ; 2484.0bp to feature; MODIFIER | silent_mutation | Average:27.582; most accessible tissue: Zhenshan97 panicle, score: 59.59 | N | N | N | N |
| vg0106294787 | C -> T | LOC_Os01g11680.1 | downstream_gene_variant ; 4157.0bp to feature; MODIFIER | silent_mutation | Average:27.582; most accessible tissue: Zhenshan97 panicle, score: 59.59 | N | N | N | N |
| vg0106294787 | C -> T | LOC_Os01g11660-LOC_Os01g11670 | intergenic_region ; MODIFIER | silent_mutation | Average:27.582; most accessible tissue: Zhenshan97 panicle, score: 59.59 | N | N | N | N |
| vg0106294787 | C -> DEL | N | N | silent_mutation | Average:27.582; most accessible tissue: Zhenshan97 panicle, score: 59.59 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0106294787 | 3.94E-10 | 1.18E-25 | mr1498 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106294787 | 9.72E-07 | 2.82E-22 | mr1769 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106294787 | 1.39E-06 | 3.02E-12 | mr1925 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106294787 | 9.02E-06 | NA | mr1951 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106294787 | 1.26E-08 | 3.59E-18 | mr1951 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106294787 | 1.42E-14 | 5.58E-20 | mr1310_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106294787 | 9.48E-08 | NA | mr1498_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106294787 | 4.00E-13 | 2.82E-24 | mr1498_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106294787 | 5.42E-09 | NA | mr1769_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106294787 | 9.86E-13 | 1.26E-29 | mr1769_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106294787 | 1.37E-09 | 2.13E-13 | mr1925_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106294787 | 4.55E-06 | NA | mr1951_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106294787 | 1.32E-09 | 1.76E-17 | mr1951_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |