\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0106218065:

Variant ID: vg0106218065 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 6218065
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCGAAAAATAATTTAATGAAAAACAATTACCATTTTACCCTTCCACCTTCCATACCTGGCATACCCTTTTAATACCTTTTTCCATGTACCTTCTCTCTCT[A/G]
TCCATTAGATCATTGCTGATCAAGGGTCCTAATTAATTTCAAGCATTAAAGAAGATCTCGTATAGTATATATTGCTAAGATTACTAAATTATATTGTTGA

Reverse complement sequence

TCAACAATATAATTTAGTAATCTTAGCAATATATACTATACGAGATCTTCTTTAATGCTTGAAATTAATTAGGACCCTTGATCAGCAATGATCTAATGGA[T/C]
AGAGAGAGAAGGTACATGGAAAAAGGTATTAAAAGGGTATGCCAGGTATGGAAGGTGGAAGGGTAAAATGGTAATTGTTTTTCATTAAATTATTTTTCGG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 38.90% 26.30% 1.18% 33.62% NA
All Indica  2759 25.70% 16.70% 1.85% 55.71% NA
All Japonica  1512 69.80% 29.00% 0.07% 1.06% NA
Aus  269 0.40% 98.90% 0.00% 0.74% NA
Indica I  595 1.70% 8.10% 1.85% 88.40% NA
Indica II  465 19.80% 21.50% 2.58% 56.13% NA
Indica III  913 50.10% 8.70% 1.75% 39.54% NA
Indica Intermediate  786 19.10% 29.90% 1.53% 49.49% NA
Temperate Japonica  767 95.00% 3.50% 0.00% 1.43% NA
Tropical Japonica  504 44.40% 54.80% 0.20% 0.60% NA
Japonica Intermediate  241 42.70% 56.40% 0.00% 0.83% NA
VI/Aromatic  96 36.50% 55.20% 1.04% 7.29% NA
Intermediate  90 41.10% 25.60% 3.33% 30.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0106218065 A -> G LOC_Os01g11550.1 downstream_gene_variant ; 3571.0bp to feature; MODIFIER silent_mutation Average:75.526; most accessible tissue: Zhenshan97 panicle, score: 91.03 N N N N
vg0106218065 A -> G LOC_Os01g11520-LOC_Os01g11550 intergenic_region ; MODIFIER silent_mutation Average:75.526; most accessible tissue: Zhenshan97 panicle, score: 91.03 N N N N
vg0106218065 A -> DEL N N silent_mutation Average:75.526; most accessible tissue: Zhenshan97 panicle, score: 91.03 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0106218065 A G 0.01 0.0 0.01 0.02 0.02 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0106218065 NA 1.58E-07 mr1180 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106218065 NA 1.15E-07 mr1183 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106218065 NA 1.46E-08 mr1207 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106218065 NA 3.87E-07 mr1503 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106218065 NA 3.75E-07 mr1756 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106218065 NA 9.54E-08 mr1063_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106218065 NA 9.34E-11 mr1180_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106218065 NA 1.91E-11 mr1183_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106218065 NA 4.82E-06 mr1295_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106218065 NA 4.23E-08 mr1310_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106218065 1.19E-06 5.29E-16 mr1769_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106218065 NA 1.27E-09 mr1769_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106218065 NA 2.01E-13 mr1769_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106218065 NA 3.31E-07 mr1792_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106218065 NA 5.42E-10 mr1794_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106218065 NA 6.13E-09 mr1829_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106218065 NA 4.53E-08 mr1943_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251