Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0106205427:

Variant ID: vg0106205427 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 6205427
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTTTAAAAATATAAAAATAATTATAATAGTTCAAGTAAGAATATAATTTATGAATAAAAGTTATCAGAGTGAAAAATGTATAATTTTAAAAAAAAAAGTC[T/C]
ATCTAGAACACAACAATGACAAATGACAATAAAGAGGGGAGAAGCAATAGGCCTGTAAATGAGGAGAGTGCTGGCGGTTTATGGGGTATCTAAAAACTAT

Reverse complement sequence

ATAGTTTTTAGATACCCCATAAACCGCCAGCACTCTCCTCATTTACAGGCCTATTGCTTCTCCCCTCTTTATTGTCATTTGTCATTGTTGTGTTCTAGAT[A/G]
GACTTTTTTTTTTAAAATTATACATTTTTCACTCTGATAACTTTTATTCATAAATTATATTCTTACTTGAACTATTATAATTATTTTTATATTTTTAAAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 78.60% 21.30% 0.04% 0.00% NA
All Indica  2759 99.20% 0.80% 0.00% 0.00% NA
All Japonica  1512 38.30% 61.60% 0.13% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 99.40% 0.60% 0.00% 0.00% NA
Indica III  913 99.70% 0.30% 0.00% 0.00% NA
Indica Intermediate  786 98.20% 1.80% 0.00% 0.00% NA
Temperate Japonica  767 5.00% 95.00% 0.00% 0.00% NA
Tropical Japonica  504 79.40% 20.60% 0.00% 0.00% NA
Japonica Intermediate  241 58.50% 40.70% 0.83% 0.00% NA
VI/Aromatic  96 62.50% 37.50% 0.00% 0.00% NA
Intermediate  90 77.80% 22.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0106205427 T -> C LOC_Os01g11520-LOC_Os01g11550 intergenic_region ; MODIFIER silent_mutation Average:26.21; most accessible tissue: Callus, score: 56.081 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0106205427 NA 3.36E-10 mr1368 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106205427 NA 7.45E-06 mr1368 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106205427 NA 5.79E-22 mr1584 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106205427 NA 1.46E-06 mr1063_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106205427 NA 3.50E-23 mr1077_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106205427 NA 5.54E-06 mr1129_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106205427 NA 6.48E-08 mr1180_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106205427 NA 1.90E-07 mr1183_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106205427 NA 5.24E-08 mr1252_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106205427 NA 2.81E-07 mr1498_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106205427 NA 3.19E-06 mr1498_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106205427 NA 7.90E-06 mr1509_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106205427 NA 6.14E-11 mr1537_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106205427 2.93E-07 NA mr1591_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106205427 2.08E-06 NA mr1594_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106205427 NA 3.77E-10 mr1595_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106205427 NA 7.30E-09 mr1624_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106205427 NA 1.07E-08 mr1741_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106205427 NA 3.32E-08 mr1746_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106205427 NA 1.85E-11 mr1769_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106205427 NA 1.47E-14 mr1769_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106205427 NA 1.80E-42 mr1771_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106205427 NA 6.63E-44 mr1784_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106205427 NA 4.15E-07 mr1785_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106205427 NA 1.44E-08 mr1794_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106205427 NA 1.78E-13 mr1800_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106205427 NA 2.61E-14 mr1827_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106205427 NA 1.67E-06 mr1840_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106205427 NA 2.83E-17 mr1842_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106205427 NA 1.90E-12 mr1844_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106205427 NA 6.63E-40 mr1862_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106205427 6.93E-06 NA mr1890_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106205427 NA 3.91E-17 mr1902_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106205427 NA 3.52E-07 mr1952_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106205427 NA 3.47E-06 mr1966_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251