| Variant ID: vg0106203527 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 6203527 |
| Reference Allele: G | Alternative Allele: C |
| Primary Allele: G | Secondary Allele: C |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, C: 0.03, others allele: 0.00, population size: 127. )
AAGACCTTTGCGGAATAATATCATCAAAAATGCAACCCAAGCATTTAACATGGACATGATACTGATTACTATACAACACAAAACTCTCGGTTGTACTTGG[G/C]
ATTCAAGTCGGACATACCACAGGTATAAACTCTAATGGTGTGTTTGGATGGTGGGTTTTGGGTGGATAAGACATGACGGTCCCTTTTTTTGGGTGTTTGG
CCAAACACCCAAAAAAAGGGACCGTCATGTCTTATCCACCCAAAACCCACCATCCAAACACACCATTAGAGTTTATACCTGTGGTATGTCCGACTTGAAT[C/G]
CCAAGTACAACCGAGAGTTTTGTGTTGTATAGTAATCAGTATCATGTCCATGTTAAATGCTTGGGTTGCATTTTTGATGATATTATTCCGCAAAGGTCTT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 70.80% | 29.10% | 0.15% | 0.00% | NA |
| All Indica | 2759 | 81.90% | 17.80% | 0.25% | 0.00% | NA |
| All Japonica | 1512 | 64.00% | 36.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 1.10% | 98.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 91.80% | 8.10% | 0.17% | 0.00% | NA |
| Indica II | 465 | 78.10% | 21.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 90.90% | 9.00% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 66.40% | 33.00% | 0.64% | 0.00% | NA |
| Temperate Japonica | 767 | 96.60% | 3.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 22.40% | 77.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 46.90% | 53.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 50.00% | 50.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 72.20% | 27.80% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0106203527 | G -> C | LOC_Os01g11520.1 | upstream_gene_variant ; 3128.0bp to feature; MODIFIER | silent_mutation | Average:44.93; most accessible tissue: Callus, score: 67.93 | N | N | N | N |
| vg0106203527 | G -> C | LOC_Os01g11520-LOC_Os01g11550 | intergenic_region ; MODIFIER | silent_mutation | Average:44.93; most accessible tissue: Callus, score: 67.93 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0106203527 | NA | 6.42E-08 | mr1002 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106203527 | NA | 1.33E-06 | mr1180 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106203527 | NA | 1.68E-06 | mr1183 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106203527 | NA | 1.34E-09 | mr1207 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106203527 | NA | 2.62E-06 | mr1236 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106203527 | NA | 9.89E-07 | mr1252 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106203527 | 4.93E-08 | 1.23E-09 | mr1498 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106203527 | NA | 3.35E-06 | mr1503 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106203527 | NA | 5.99E-07 | mr1756 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106203527 | 1.88E-09 | 7.13E-14 | mr1769 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/