\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0106130897:

Variant ID: vg0106130897 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 6130897
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 127. )

Flanking Sequence (100 bp) in Reference Genome:


GTTTTGCTAAGATGGCATACATAACTCGCCTATTTGTAAATAGATTTGAAATAGCACATGGATGGATGGATGGAGCACTGGATTGTCCTGGACTAACGGC[A/T]
CAAGTTAAGATCTAAAAAATAAGTTTAATAATAATAATAATAAAATAACTGATGAACCTGCTGATCTGTTGGATGAGAGTGGTAGATCTATTCCTCAGGA

Reverse complement sequence

TCCTGAGGAATAGATCTACCACTCTCATCCAACAGATCAGCAGGTTCATCAGTTATTTTATTATTATTATTATTAAACTTATTTTTTAGATCTTAACTTG[T/A]
GCCGTTAGTCCAGGACAATCCAGTGCTCCATCCATCCATCCATGTGCTATTTCAAATCTATTTACAAATAGGCGAGTTATGTATGCCATCTTAGCAAAAC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.40% 12.60% 0.00% 0.00% NA
All Indica  2759 91.50% 8.50% 0.00% 0.00% NA
All Japonica  1512 76.70% 23.30% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 92.10% 7.90% 0.00% 0.00% NA
Indica II  465 99.10% 0.90% 0.00% 0.00% NA
Indica III  913 98.50% 1.50% 0.00% 0.00% NA
Indica Intermediate  786 78.50% 21.50% 0.00% 0.00% NA
Temperate Japonica  767 98.60% 1.40% 0.00% 0.00% NA
Tropical Japonica  504 36.50% 63.50% 0.00% 0.00% NA
Japonica Intermediate  241 90.90% 9.10% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 90.00% 10.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0106130897 A -> T LOC_Os01g11390.1 upstream_gene_variant ; 1160.0bp to feature; MODIFIER silent_mutation Average:57.727; most accessible tissue: Zhenshan97 root, score: 90.735 N N N N
vg0106130897 A -> T LOC_Os01g11414.1 upstream_gene_variant ; 3305.0bp to feature; MODIFIER silent_mutation Average:57.727; most accessible tissue: Zhenshan97 root, score: 90.735 N N N N
vg0106130897 A -> T LOC_Os01g11400.1 downstream_gene_variant ; 1393.0bp to feature; MODIFIER silent_mutation Average:57.727; most accessible tissue: Zhenshan97 root, score: 90.735 N N N N
vg0106130897 A -> T LOC_Os01g11390-LOC_Os01g11400 intergenic_region ; MODIFIER silent_mutation Average:57.727; most accessible tissue: Zhenshan97 root, score: 90.735 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0106130897 NA 1.40E-17 mr1593 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106130897 NA 1.56E-13 mr1771 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106130897 NA 2.60E-12 mr1784 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106130897 NA 8.50E-12 mr1800 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106130897 NA 3.23E-06 mr1830 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106130897 NA 4.78E-06 mr1398_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106130897 NA 5.94E-06 mr1553_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106130897 NA 1.00E-06 mr1705_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106130897 NA 1.20E-10 mr1769_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106130897 NA 4.66E-10 mr1784_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106130897 NA 8.44E-10 mr1862_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106130897 NA 3.32E-07 mr1943_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251