\
| Variant ID: vg0106130897 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 6130897 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 127. )
GTTTTGCTAAGATGGCATACATAACTCGCCTATTTGTAAATAGATTTGAAATAGCACATGGATGGATGGATGGAGCACTGGATTGTCCTGGACTAACGGC[A/T]
CAAGTTAAGATCTAAAAAATAAGTTTAATAATAATAATAATAAAATAACTGATGAACCTGCTGATCTGTTGGATGAGAGTGGTAGATCTATTCCTCAGGA
TCCTGAGGAATAGATCTACCACTCTCATCCAACAGATCAGCAGGTTCATCAGTTATTTTATTATTATTATTATTAAACTTATTTTTTAGATCTTAACTTG[T/A]
GCCGTTAGTCCAGGACAATCCAGTGCTCCATCCATCCATCCATGTGCTATTTCAAATCTATTTACAAATAGGCGAGTTATGTATGCCATCTTAGCAAAAC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 87.40% | 12.60% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 91.50% | 8.50% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 76.70% | 23.30% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 92.10% | 7.90% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 78.50% | 21.50% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 98.60% | 1.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 36.50% | 63.50% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 90.90% | 9.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 90.00% | 10.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0106130897 | A -> T | LOC_Os01g11390.1 | upstream_gene_variant ; 1160.0bp to feature; MODIFIER | silent_mutation | Average:57.727; most accessible tissue: Zhenshan97 root, score: 90.735 | N | N | N | N |
| vg0106130897 | A -> T | LOC_Os01g11414.1 | upstream_gene_variant ; 3305.0bp to feature; MODIFIER | silent_mutation | Average:57.727; most accessible tissue: Zhenshan97 root, score: 90.735 | N | N | N | N |
| vg0106130897 | A -> T | LOC_Os01g11400.1 | downstream_gene_variant ; 1393.0bp to feature; MODIFIER | silent_mutation | Average:57.727; most accessible tissue: Zhenshan97 root, score: 90.735 | N | N | N | N |
| vg0106130897 | A -> T | LOC_Os01g11390-LOC_Os01g11400 | intergenic_region ; MODIFIER | silent_mutation | Average:57.727; most accessible tissue: Zhenshan97 root, score: 90.735 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0106130897 | NA | 1.40E-17 | mr1593 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106130897 | NA | 1.56E-13 | mr1771 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106130897 | NA | 2.60E-12 | mr1784 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106130897 | NA | 8.50E-12 | mr1800 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106130897 | NA | 3.23E-06 | mr1830 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106130897 | NA | 4.78E-06 | mr1398_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106130897 | NA | 5.94E-06 | mr1553_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106130897 | NA | 1.00E-06 | mr1705_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106130897 | NA | 1.20E-10 | mr1769_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106130897 | NA | 4.66E-10 | mr1784_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106130897 | NA | 8.44E-10 | mr1862_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106130897 | NA | 3.32E-07 | mr1943_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |