Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0106106067:

Variant ID: vg0106106067 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 6106067
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.68, C: 0.32, others allele: 0.00, population size: 177. )

Flanking Sequence (100 bp) in Reference Genome:


TGTGACCCAAGAAGTATATACGTGGGAACACCACTGGACGTATCTGCCCACTCTCATAACACTGTACATGTACAAATACTGGTGTGTCCTCTTAAATACA[C/T]
GCTTAAAAAAATGTGTACGGACAATAATAAACCCTTGACTTCTCTAAAATCTTATTGAAGATACAACACTTTATGTGCATAATTAATTATGGGCATTATA

Reverse complement sequence

TATAATGCCCATAATTAATTATGCACATAAAGTGTTGTATCTTCAATAAGATTTTAGAGAAGTCAAGGGTTTATTATTGTCCGTACACATTTTTTTAAGC[G/A]
TGTATTTAAGAGGACACACCAGTATTTGTACATGTACAGTGTTATGAGAGTGGGCAGATACGTCCAGTGGTGTTCCCACGTATATACTTCTTGGGTCACA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 70.00% 28.60% 1.14% 0.30% NA
All Indica  2759 79.60% 17.90% 1.92% 0.51% NA
All Japonica  1512 65.50% 34.50% 0.07% 0.00% NA
Aus  269 1.10% 98.90% 0.00% 0.00% NA
Indica I  595 92.10% 7.90% 0.00% 0.00% NA
Indica II  465 76.80% 22.20% 1.08% 0.00% NA
Indica III  913 84.60% 9.50% 4.71% 1.20% NA
Indica Intermediate  786 66.20% 32.80% 0.64% 0.38% NA
Temperate Japonica  767 96.50% 3.50% 0.00% 0.00% NA
Tropical Japonica  504 29.00% 71.00% 0.00% 0.00% NA
Japonica Intermediate  241 43.20% 56.40% 0.41% 0.00% NA
VI/Aromatic  96 51.00% 49.00% 0.00% 0.00% NA
Intermediate  90 74.40% 25.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0106106067 C -> T LOC_Os01g11360.1 downstream_gene_variant ; 2891.0bp to feature; MODIFIER silent_mutation Average:60.134; most accessible tissue: Callus, score: 80.692 N N N N
vg0106106067 C -> T LOC_Os01g11350-LOC_Os01g11360 intergenic_region ; MODIFIER silent_mutation Average:60.134; most accessible tissue: Callus, score: 80.692 N N N N
vg0106106067 C -> DEL N N silent_mutation Average:60.134; most accessible tissue: Callus, score: 80.692 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0106106067 NA 7.17E-08 mr1002 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106106067 5.21E-06 4.84E-11 mr1207 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106106067 NA 3.61E-06 mr1345 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106106067 NA 4.15E-07 mr1368 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106106067 1.65E-08 4.36E-10 mr1498 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106106067 NA 8.40E-08 mr1756 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106106067 2.96E-06 4.84E-12 mr1769 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106106067 1.59E-07 1.72E-12 mr1769 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106106067 NA 2.57E-06 mr1925 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106106067 NA 9.21E-06 mr1943 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106106067 2.06E-06 NA mr1951 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106106067 3.22E-08 2.07E-07 mr1951 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106106067 NA 5.45E-07 mr1063_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106106067 NA 5.22E-09 mr1180_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106106067 NA 6.80E-09 mr1183_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106106067 NA 7.59E-06 mr1236_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106106067 NA 2.07E-06 mr1295_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106106067 4.78E-06 3.43E-11 mr1310_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106106067 NA 3.96E-07 mr1350_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106106067 NA 4.07E-06 mr1363_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106106067 NA 1.18E-07 mr1498_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106106067 NA 3.15E-09 mr1498_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106106067 5.39E-10 1.04E-20 mr1769_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106106067 4.56E-07 4.43E-15 mr1769_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106106067 NA 5.38E-13 mr1769_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106106067 NA 1.17E-06 mr1792_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106106067 NA 1.06E-08 mr1794_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106106067 NA 1.58E-07 mr1808_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106106067 NA 5.87E-09 mr1943_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106106067 NA 1.77E-06 mr1951_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251