Variant ID: vg0106102408 (JBrowse) | Variation Type: SNP |
Chromosome: chr01 | Position: 6102408 |
Reference Allele: G | Alternative Allele: A |
Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TTTACTCACGAAGTGGTTTTGGAGATGATTGGATTCACAGGTGATTTCATGTAACCGGTTAGACCGGGCTCTGGTAGCCGGTCAGACCGGCGTGTAATGC[G/A]
CGGTCAGACCGGCGCAGCCCGCGGTCTGACCGGCCGATACTGTGTCGGTTTCGGTTTCGGGTTGTTTGTTTGTATATCCGAGTTTATTTCTTGATTATGA
TCATAATCAAGAAATAAACTCGGATATACAAACAAACAACCCGAAACCGAAACCGACACAGTATCGGCCGGTCAGACCGCGGGCTGCGCCGGTCTGACCG[C/T]
GCATTACACGCCGGTCTGACCGGCTACCAGAGCCCGGTCTAACCGGTTACATGAAATCACCTGTGAATCCAATCATCTCCAAAACCACTTCGTGAGTAAA
Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 96.80% | 3.20% | 0.00% | 0.00% | NA |
All Indica | 2759 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
All Japonica | 1512 | 90.30% | 9.70% | 0.00% | 0.00% | NA |
Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
Temperate Japonica | 767 | 98.00% | 2.00% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 94.20% | 5.80% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 57.30% | 42.70% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 96.70% | 3.30% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0106102408 | G -> A | LOC_Os01g11350-LOC_Os01g11360 | intergenic_region ; MODIFIER | silent_mutation | Average:51.495; most accessible tissue: Minghui63 panicle, score: 73.225 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0106102408 | NA | 6.29E-06 | mr1114 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0106102408 | 7.53E-06 | 2.47E-09 | mr1117 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0106102408 | NA | 9.50E-08 | mr1118 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0106102408 | NA | 1.31E-07 | mr1119 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0106102408 | NA | 1.94E-06 | mr1120 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0106102408 | NA | 5.03E-09 | mr1123 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0106102408 | NA | 1.81E-08 | mr1180 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0106102408 | NA | 6.31E-07 | mr1183 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0106102408 | NA | 5.85E-06 | mr1240 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0106102408 | NA | 3.58E-08 | mr1242 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/