\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0106100583:

Variant ID: vg0106100583 (JBrowse)Variation Type: INDEL
Chromosome: chr01Position: 6100583
Reference Allele: CAAlternative Allele: TA,C
Primary Allele: CASecondary Allele: TA

Inferred Ancestral Allele : CA (evidence from allele frequency in Oryza rufipogon: CA: 1.00, others allele: 0.00, population size: 96. )

Flanking Sequence (100 bp) in Reference Genome:


AGTACTATTTTTTTTCTTAAAAATATACATGCATTAAATCGGAATAATGAAATACTCCGTATCATGTATCATGTGGCTCTCGATAGTACTTTATCCGTTT[CA/TA,C]
TAAAAAACCAAAACGTATTTGAATCTGAGTAAGATATGTCACGTTCAATCATATTTTCTTTAAGGATAAAGGGAGTACGGTTTTATCTACCGGCGAAAAT

Reverse complement sequence

ATTTTCGCCGGTAGATAAAACCGTACTCCCTTTATCCTTAAAGAAAATATGATTGAACGTGACATATCTTACTCAGATTCAAATACGTTTTGGTTTTTTA[TG/TA,G]
AAACGGATAAAGTACTATCGAGAGCCACATGATACATGATACGGAGTATTTCATTATTCCGATTTAATGCATGTATATTTTTAAGAAAAAAAATAGTACT

Allele Frequencies:

Populations Population SizeFrequency of CA(primary allele) Frequency of TA(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 72.60% 16.80% 0.13% 0.00% C: 10.52%
All Indica  2759 69.40% 22.80% 0.07% 0.00% C: 7.68%
All Japonica  1512 89.10% 10.00% 0.26% 0.00% C: 0.66%
Aus  269 18.20% 0.00% 0.00% 0.00% C: 81.78%
Indica I  595 99.70% 0.30% 0.00% 0.00% NA
Indica II  465 62.80% 15.70% 0.00% 0.00% C: 21.51%
Indica III  913 46.50% 48.60% 0.11% 0.00% C: 4.71%
Indica Intermediate  786 77.10% 14.00% 0.13% 0.00% C: 8.78%
Temperate Japonica  767 97.90% 2.00% 0.00% 0.00% C: 0.13%
Tropical Japonica  504 92.30% 6.30% 0.00% 0.00% C: 1.39%
Japonica Intermediate  241 54.40% 43.20% 1.66% 0.00% C: 0.83%
VI/Aromatic  96 52.10% 0.00% 0.00% 0.00% C: 47.92%
Intermediate  90 74.40% 15.60% 0.00% 0.00% C: 10.00%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0106100583 CA -> TA LOC_Os01g11350.1 upstream_gene_variant ; 4055.0bp to feature; MODIFIER silent_mutation Average:94.609; most accessible tissue: Minghui63 root, score: 97.399 N N N N
vg0106100583 CA -> TA LOC_Os01g11350-LOC_Os01g11360 intergenic_region ; MODIFIER silent_mutation Average:94.609; most accessible tissue: Minghui63 root, score: 97.399 N N N N
vg0106100583 CA -> C LOC_Os01g11350.1 upstream_gene_variant ; 4056.0bp to feature; MODIFIER silent_mutation Average:94.609; most accessible tissue: Minghui63 root, score: 97.399 N N N N
vg0106100583 CA -> C LOC_Os01g11350-LOC_Os01g11360 intergenic_region ; MODIFIER silent_mutation Average:94.609; most accessible tissue: Minghui63 root, score: 97.399 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0106100583 CA C 0.11 -0.03 -0.05 -0.07 -0.04 -0.04
vg0106100583 CA TA 0.03 0.03 0.01 0.02 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0106100583 NA 4.57E-06 mr1118 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106100583 2.71E-06 1.07E-08 mr1691 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106100583 3.15E-06 5.41E-12 mr1693 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106100583 4.79E-06 1.33E-07 mr1720 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106100583 NA 2.48E-07 mr1180_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106100583 NA 1.67E-07 mr1183_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106100583 NA 3.66E-06 mr1496_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106100583 NA 1.95E-08 mr1691_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106100583 9.19E-06 1.59E-09 mr1691_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106100583 NA 8.13E-08 mr1720_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251