\
| Variant ID: vg0106088288 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 6088288 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GGCACCACGTTCGCTGTGGGGGCTAGAAATTCCCACATTAATCGGAGAAAAAGAAGAGTACAAGTAGAAATACGATTTAAAAATAGCTGAAATTCGAAAT[T/A]
AAAAATAAGTAACATTGAAAGAAGTTTCCATATAACAACCCAATAGGAGTTTAATCAAAATTCGAAATAAAAATAAAATAAAATCTAAAATTAGAAAAAG
CTTTTTCTAATTTTAGATTTTATTTTATTTTTATTTCGAATTTTGATTAAACTCCTATTGGGTTGTTATATGGAAACTTCTTTCAATGTTACTTATTTTT[A/T]
ATTTCGAATTTCAGCTATTTTTAAATCGTATTTCTACTTGTACTCTTCTTTTTCTCCGATTAATGTGGGAATTTCTAGCCCCCACAGCGAACGTGGTGCC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 85.10% | 1.10% | 1.61% | 12.23% | NA |
| All Indica | 2759 | 78.50% | 0.00% | 0.91% | 20.59% | NA |
| All Japonica | 1512 | 94.40% | 2.20% | 3.17% | 0.20% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 97.30% | 0.00% | 2.35% | 0.34% | NA |
| Indica II | 465 | 84.50% | 0.20% | 0.22% | 15.05% | NA |
| Indica III | 913 | 55.00% | 0.00% | 0.44% | 44.58% | NA |
| Indica Intermediate | 786 | 87.90% | 0.00% | 0.76% | 11.32% | NA |
| Temperate Japonica | 767 | 90.90% | 3.40% | 5.74% | 0.00% | NA |
| Tropical Japonica | 504 | 99.00% | 0.60% | 0.00% | 0.40% | NA |
| Japonica Intermediate | 241 | 96.30% | 1.70% | 1.66% | 0.41% | NA |
| VI/Aromatic | 96 | 81.20% | 17.70% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 88.90% | 1.10% | 2.22% | 7.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0106088288 | T -> A | LOC_Os01g11340-LOC_Os01g11350 | intergenic_region ; MODIFIER | silent_mutation | Average:11.644; most accessible tissue: Zhenshan97 flag leaf, score: 26.688 | N | N | N | N |
| vg0106088288 | T -> DEL | N | N | silent_mutation | Average:11.644; most accessible tissue: Zhenshan97 flag leaf, score: 26.688 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0106088288 | 7.58E-06 | 7.14E-07 | mr1062 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106088288 | 5.02E-07 | 5.02E-07 | mr1389 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |