\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0105995926:

Variant ID: vg0105995926 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 5995926
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATCAGCCGTGGTTTTGATCTCGTCTGTGCCCCTTTGTGTCACGCCCCGAACTAGCCCCGAGCGGAACTAACCCGTGACGCTCCAAATTAACCTATTAATC[G/T]
ATACCAGTCCCAGGAAACAGTGCTGGTATCACAGGAAGACAGAATATCACAGCAACAGAGGTCTCTTTATTATAGAGTAGGAGTACAGTCATGTTGGGCT

Reverse complement sequence

AGCCCAACATGACTGTACTCCTACTCTATAATAAAGAGACCTCTGTTGCTGTGATATTCTGTCTTCCTGTGATACCAGCACTGTTTCCTGGGACTGGTAT[C/A]
GATTAATAGGTTAATTTGGAGCGTCACGGGTTAGTTCCGCTCGGGGCTAGTTCGGGGCGTGACACAAAGGGGCACAGACGAGATCAAAACCACGGCTGAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.30% 3.60% 3.09% 6.01% NA
All Indica  2759 84.70% 0.10% 5.15% 10.08% NA
All Japonica  1512 88.90% 11.00% 0.00% 0.13% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.70% 0.00% 0.00% 0.34% NA
Indica II  465 87.30% 0.00% 2.37% 10.32% NA
Indica III  913 68.90% 0.10% 11.94% 19.06% NA
Indica Intermediate  786 90.20% 0.10% 2.80% 6.87% NA
Temperate Japonica  767 97.40% 2.60% 0.00% 0.00% NA
Tropical Japonica  504 93.50% 6.30% 0.00% 0.20% NA
Japonica Intermediate  241 52.30% 47.30% 0.00% 0.41% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 86.70% 4.40% 4.44% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0105995926 G -> T LOC_Os01g11170.1 downstream_gene_variant ; 4092.0bp to feature; MODIFIER silent_mutation Average:45.742; most accessible tissue: Zhenshan97 flag leaf, score: 62.519 N N N N
vg0105995926 G -> T LOC_Os01g11190.1 downstream_gene_variant ; 471.0bp to feature; MODIFIER silent_mutation Average:45.742; most accessible tissue: Zhenshan97 flag leaf, score: 62.519 N N N N
vg0105995926 G -> T LOC_Os01g11200.1 downstream_gene_variant ; 4407.0bp to feature; MODIFIER silent_mutation Average:45.742; most accessible tissue: Zhenshan97 flag leaf, score: 62.519 N N N N
vg0105995926 G -> T LOC_Os01g11190-LOC_Os01g11200 intergenic_region ; MODIFIER silent_mutation Average:45.742; most accessible tissue: Zhenshan97 flag leaf, score: 62.519 N N N N
vg0105995926 G -> DEL N N silent_mutation Average:45.742; most accessible tissue: Zhenshan97 flag leaf, score: 62.519 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0105995926 NA 7.81E-07 mr1114 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105995926 NA 7.06E-08 mr1117 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105995926 NA 1.81E-08 mr1118 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105995926 NA 5.76E-07 mr1119 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105995926 NA 5.02E-06 mr1120 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105995926 NA 4.53E-09 mr1123 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105995926 NA 1.55E-06 mr1240 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105995926 NA 6.38E-09 mr1242 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105995926 NA 7.89E-07 mr1247 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105995926 NA 3.12E-07 mr1495 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105995926 NA 1.86E-07 mr1496 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105995926 2.79E-07 1.02E-08 mr1691 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105995926 1.43E-07 1.74E-11 mr1693 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105995926 NA 5.62E-07 mr1961 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105995926 NA 1.73E-06 mr1113_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105995926 NA 1.18E-07 mr1114_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105995926 NA 6.45E-09 mr1117_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105995926 6.51E-06 1.51E-08 mr1118_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105995926 NA 1.82E-08 mr1119_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105995926 NA 1.69E-07 mr1120_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105995926 NA 1.56E-08 mr1123_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105995926 NA 1.03E-09 mr1240_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105995926 7.29E-06 4.67E-09 mr1242_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105995926 NA 1.50E-07 mr1247_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105995926 NA 1.38E-07 mr1495_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105995926 3.60E-06 8.51E-11 mr1496_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105995926 1.96E-06 1.90E-09 mr1691_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105995926 NA 1.09E-07 mr1720_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105995926 NA 1.88E-06 mr1936_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251