\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0105903122:

Variant ID: vg0105903122 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 5903122
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.88, A: 0.12, others allele: 0.00, population size: 105. )

Flanking Sequence (100 bp) in Reference Genome:


GTAAAAAAACCCAATGATAATCATGTTCGATTTTAAAATCTCAATGACAATAAAGAAAGTAGGCAGCGGGCGAGCCGTAGAGGAGTACAATGGCAAAGCC[G/A]
CTGATGGTTTGGCGAGACTTCTAGAAAGTAAAAATGAACCCAAACGATAATTATGTTTGATTTTTAAAATCTCAATGACAATAAAGAGAAGAAACAGTGG

Reverse complement sequence

CCACTGTTTCTTCTCTTTATTGTCATTGAGATTTTAAAAATCAAACATAATTATCGTTTGGGTTCATTTTTACTTTCTAGAAGTCTCGCCAAACCATCAG[C/T]
GGCTTTGCCATTGTACTCCTCTACGGCTCGCCCGCTGCCTACTTTCTTTATTGTCATTGAGATTTTAAAATCGAACATGATTATCATTGGGTTTTTTTAC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.80% 29.70% 2.58% 0.00% NA
All Indica  2759 65.70% 30.50% 3.73% 0.00% NA
All Japonica  1512 79.40% 20.20% 0.46% 0.00% NA
Aus  269 15.20% 81.00% 3.72% 0.00% NA
Indica I  595 91.40% 6.90% 1.68% 0.00% NA
Indica II  465 65.40% 32.30% 2.37% 0.00% NA
Indica III  913 50.80% 45.30% 3.83% 0.00% NA
Indica Intermediate  786 63.90% 30.20% 5.98% 0.00% NA
Temperate Japonica  767 95.80% 4.00% 0.13% 0.00% NA
Tropical Japonica  504 69.80% 29.40% 0.79% 0.00% NA
Japonica Intermediate  241 46.90% 52.30% 0.83% 0.00% NA
VI/Aromatic  96 83.30% 15.60% 1.04% 0.00% NA
Intermediate  90 74.40% 24.40% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0105903122 G -> A LOC_Os01g11054.3 upstream_gene_variant ; 1908.0bp to feature; MODIFIER silent_mutation Average:36.727; most accessible tissue: Zhenshan97 flag leaf, score: 50.663 N N N N
vg0105903122 G -> A LOC_Os01g11054.2 upstream_gene_variant ; 2933.0bp to feature; MODIFIER silent_mutation Average:36.727; most accessible tissue: Zhenshan97 flag leaf, score: 50.663 N N N N
vg0105903122 G -> A LOC_Os01g11054.4 upstream_gene_variant ; 3957.0bp to feature; MODIFIER silent_mutation Average:36.727; most accessible tissue: Zhenshan97 flag leaf, score: 50.663 N N N N
vg0105903122 G -> A LOC_Os01g11040.1 downstream_gene_variant ; 4898.0bp to feature; MODIFIER silent_mutation Average:36.727; most accessible tissue: Zhenshan97 flag leaf, score: 50.663 N N N N
vg0105903122 G -> A LOC_Os01g11054.1 intron_variant ; MODIFIER silent_mutation Average:36.727; most accessible tissue: Zhenshan97 flag leaf, score: 50.663 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0105903122 NA 3.03E-06 mr1104_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105903122 3.47E-06 3.47E-06 mr1145_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105903122 8.12E-06 1.34E-08 mr1155_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105903122 NA 8.52E-08 mr1180_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105903122 NA 2.15E-07 mr1183_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105903122 3.94E-06 3.95E-06 mr1264_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105903122 7.19E-06 NA mr1408_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105903122 NA 8.41E-06 mr1437_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251