\
| Variant ID: vg0105889711 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 5889711 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 109. )
CATTCTCCTCGACTGCGTGTTCGCTCGGCAGGTCTGGCTCCGGGTGTTGTCGCCTTCTGGCCGGTCTGCCCTCTCTCCACCCCGTGGCAATTGGTTCCAG[G/A]
ACTGGTGGCCATCCTCTAGGGCCTGCTTACCAGAGCACCTCCGCGACAGCTTCGACTCCATGGTGCTCCTGGTCTCTTGGTGTCTGTGGAAGGAGCGGAA
TTCCGCTCCTTCCACAGACACCAAGAGACCAGGAGCACCATGGAGTCGAAGCTGTCGCGGAGGTGCTCTGGTAAGCAGGCCCTAGAGGATGGCCACCAGT[C/T]
CTGGAACCAATTGCCACGGGGTGGAGAGAGGGCAGACCGGCCAGAAGGCGACAACACCCGGAGCCAGACCTGCCGAGCGAACACGCAGTCGAGGAGAATG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 78.30% | 21.70% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 84.10% | 15.90% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 79.40% | 20.60% | 0.00% | 0.00% | NA |
| Aus | 269 | 10.80% | 89.20% | 0.00% | 0.00% | NA |
| Indica I | 595 | 91.60% | 8.40% | 0.00% | 0.00% | NA |
| Indica II | 465 | 78.50% | 21.50% | 0.00% | 0.00% | NA |
| Indica III | 913 | 92.70% | 7.30% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 71.60% | 28.40% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 95.70% | 4.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 70.20% | 29.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 46.90% | 53.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 83.30% | 16.70% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 81.10% | 18.90% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0105889711 | G -> A | LOC_Os01g11040.1 | upstream_gene_variant ; 894.0bp to feature; MODIFIER | silent_mutation | Average:59.768; most accessible tissue: Minghui63 flower, score: 70.218 | N | N | N | N |
| vg0105889711 | G -> A | LOC_Os01g11020-LOC_Os01g11040 | intergenic_region ; MODIFIER | silent_mutation | Average:59.768; most accessible tissue: Minghui63 flower, score: 70.218 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0105889711 | NA | 3.03E-06 | mr1180 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105889711 | 4.01E-06 | NA | mr1498 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105889711 | 9.39E-08 | 1.20E-11 | mr1769 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105889711 | NA | 6.26E-06 | mr1943 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105889711 | 5.18E-06 | NA | mr1951 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105889711 | NA | 3.35E-06 | mr1155_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105889711 | NA | 2.30E-08 | mr1180_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105889711 | NA | 7.43E-08 | mr1183_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105889711 | NA | 1.27E-10 | mr1310_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105889711 | NA | 1.33E-07 | mr1498_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105889711 | NA | 1.97E-07 | mr1740_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105889711 | 9.12E-06 | 6.75E-12 | mr1769_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105889711 | NA | 6.28E-12 | mr1769_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105889711 | NA | 1.66E-07 | mr1794_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105889711 | NA | 5.71E-09 | mr1829_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105889711 | NA | 1.85E-06 | mr1924_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105889711 | NA | 9.05E-09 | mr1943_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |