\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0105783977:

Variant ID: vg0105783977 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 5783977
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.97, G: 0.03, others allele: 0.00, population size: 59. )

Flanking Sequence (100 bp) in Reference Genome:


TACTCGCTTTGAGATTCTATATTAATTGACATTTTGGACAAGATTGAAGTTAAATTTTTATAACTTTGACCATTAATAACTAAAAATATTTAGTTTAAAG[A/G]
AACTAGAAAAACATATACATTTATTTATTGTATATATTATAATAGAAAAATAAGGTCAAAGGTATATCTTATGGAACGTGTAATTGTCCAAAGCGTTAAT

Reverse complement sequence

ATTAACGCTTTGGACAATTACACGTTCCATAAGATATACCTTTGACCTTATTTTTCTATTATAATATATACAATAAATAAATGTATATGTTTTTCTAGTT[T/C]
CTTTAAACTAAATATTTTTAGTTATTAATGGTCAAAGTTATAAAAATTTAACTTCAATCTTGTCCAAAATGTCAATTAATATAGAATCTCAAAGCGAGTA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 79.00% 21.00% 0.02% 0.00% NA
All Indica  2759 84.40% 15.60% 0.00% 0.00% NA
All Japonica  1512 79.40% 20.60% 0.00% 0.00% NA
Aus  269 17.50% 82.20% 0.37% 0.00% NA
Indica I  595 90.80% 9.20% 0.00% 0.00% NA
Indica II  465 78.70% 21.30% 0.00% 0.00% NA
Indica III  913 93.50% 6.50% 0.00% 0.00% NA
Indica Intermediate  786 72.40% 27.60% 0.00% 0.00% NA
Temperate Japonica  767 95.70% 4.30% 0.00% 0.00% NA
Tropical Japonica  504 70.60% 29.40% 0.00% 0.00% NA
Japonica Intermediate  241 45.60% 54.40% 0.00% 0.00% NA
VI/Aromatic  96 84.40% 15.60% 0.00% 0.00% NA
Intermediate  90 83.30% 16.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0105783977 A -> G LOC_Os01g10840-LOC_Os01g10850 intergenic_region ; MODIFIER silent_mutation Average:68.008; most accessible tissue: Callus, score: 95.945 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0105783977 A G -0.01 -0.02 -0.01 -0.01 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0105783977 NA 3.03E-06 mr1180 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105783977 2.12E-07 NA mr1498 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105783977 NA 7.99E-06 mr1644 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105783977 2.18E-06 2.99E-10 mr1769 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105783977 2.18E-06 NA mr1951 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105783977 NA 3.35E-06 mr1155_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105783977 NA 2.30E-08 mr1180_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105783977 NA 7.43E-08 mr1183_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105783977 NA 1.08E-09 mr1310_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105783977 NA 5.07E-08 mr1498_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105783977 1.15E-06 2.04E-13 mr1769_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105783977 NA 9.21E-12 mr1769_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105783977 NA 1.66E-07 mr1794_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105783977 NA 1.88E-06 mr1924_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105783977 NA 3.17E-09 mr1943_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251