\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0105763607:

Variant ID: vg0105763607 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 5763607
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, others allele: 0.00, population size: 313. )

Flanking Sequence (100 bp) in Reference Genome:


GGATGGCAGATTTGAGTTTAAGCTCGAAAAGAACTGATTTAGGAGATGGATGTGGTAGTCAAAGTCAAGGGAACAGGATCCACCTTGATTACACAGTGGG[T/C]
GGTCATACTTCATCTGTTTCTTGCGTGTAAGTCCCACTATGTTGTTTCTCTGTAATTTCTTACATATCTTACCCTTTTACTAACTGCTTAATACTTTAAC

Reverse complement sequence

GTTAAAGTATTAAGCAGTTAGTAAAAGGGTAAGATATGTAAGAAATTACAGAGAAACAACATAGTGGGACTTACACGCAAGAAACAGATGAAGTATGACC[A/G]
CCCACTGTGTAATCAAGGTGGATCCTGTTCCCTTGACTTTGACTACCACATCCATCTCCTAAATCAGTTCTTTTCGAGCTTAAACTCAAATCTGCCATCC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.70% 1.80% 0.61% 6.90% NA
All Indica  2759 91.40% 2.20% 0.98% 5.36% NA
All Japonica  1512 88.70% 1.10% 0.07% 10.19% NA
Aus  269 89.20% 3.00% 0.37% 7.43% NA
Indica I  595 90.60% 2.40% 0.17% 6.89% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 96.70% 0.30% 1.20% 1.75% NA
Indica Intermediate  786 80.80% 5.70% 1.91% 11.58% NA
Temperate Japonica  767 98.80% 0.00% 0.00% 1.17% NA
Tropical Japonica  504 76.60% 2.80% 0.20% 20.44% NA
Japonica Intermediate  241 81.70% 0.80% 0.00% 17.43% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 95.60% 0.00% 0.00% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0105763607 T -> DEL LOC_Os01g10790.1 N frameshift_variant Average:74.635; most accessible tissue: Minghui63 flag leaf, score: 86.0 N N N N
vg0105763607 T -> C LOC_Os01g10790.1 synonymous_variant ; p.Gly294Gly; LOW synonymous_codon Average:74.635; most accessible tissue: Minghui63 flag leaf, score: 86.0 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0105763607 T C -0.01 0.0 0.0 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0105763607 NA 9.12E-06 mr1721 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105763607 NA 5.04E-06 mr1077_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105763607 NA 3.48E-06 mr1090_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105763607 NA 4.15E-06 mr1206_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105763607 NA 4.65E-08 mr1248_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105763607 NA 2.88E-07 mr1250_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105763607 NA 3.82E-06 mr1405_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105763607 NA 3.21E-07 mr1533_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105763607 4.80E-06 NA mr1580_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105763607 NA 3.58E-06 mr1739_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105763607 5.42E-06 NA mr1825_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105763607 NA 1.43E-06 mr1825_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105763607 NA 3.56E-06 mr1924_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105763607 NA 5.82E-07 mr1943_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251