Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0105761092:

Variant ID: vg0105761092 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 5761092
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 281. )

Flanking Sequence (100 bp) in Reference Genome:


AGGCACTAGTAGGCAATAGTCATGTGGCCGATCTATAGAGGTCTTGCATCTCTGACGGCAAACTGAGATAATCATTCCACTGCTGTGTACAATAATGCAC[T/C]
GGTAACTTTGTGAAAGTAGCAACCTGCATAACCATAGATTAGTATCCAGTTCCCTATTTCACCTTGTCCTTGCTGCTTCCTGATGGCACTTGAGTTCACT

Reverse complement sequence

AGTGAACTCAAGTGCCATCAGGAAGCAGCAAGGACAAGGTGAAATAGGGAACTGGATACTAATCTATGGTTATGCAGGTTGCTACTTTCACAAAGTTACC[A/G]
GTGCATTATTGTACACAGCAGTGGAATGATTATCTCAGTTTGCCGTCAGAGATGCAAGACCTCTATAGATCGGCCACATGACTATTGCCTACTAGTGCCT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 75.10% 24.40% 0.13% 0.34% NA
All Indica  2759 65.30% 33.90% 0.14% 0.58% NA
All Japonica  1512 88.40% 11.50% 0.13% 0.00% NA
Aus  269 89.20% 10.80% 0.00% 0.00% NA
Indica I  595 11.30% 87.20% 0.34% 1.18% NA
Indica II  465 91.80% 7.50% 0.22% 0.43% NA
Indica III  913 88.20% 11.20% 0.11% 0.55% NA
Indica Intermediate  786 64.10% 35.60% 0.00% 0.25% NA
Temperate Japonica  767 98.40% 1.60% 0.00% 0.00% NA
Tropical Japonica  504 76.20% 23.40% 0.40% 0.00% NA
Japonica Intermediate  241 81.70% 18.30% 0.00% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 87.80% 12.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0105761092 T -> DEL N N silent_mutation Average:81.022; most accessible tissue: Minghui63 flag leaf, score: 91.823 N N N N
vg0105761092 T -> C LOC_Os01g10770.1 upstream_gene_variant ; 2485.0bp to feature; MODIFIER silent_mutation Average:81.022; most accessible tissue: Minghui63 flag leaf, score: 91.823 N N N N
vg0105761092 T -> C LOC_Os01g10780.1 upstream_gene_variant ; 858.0bp to feature; MODIFIER silent_mutation Average:81.022; most accessible tissue: Minghui63 flag leaf, score: 91.823 N N N N
vg0105761092 T -> C LOC_Os01g10800.1 downstream_gene_variant ; 3560.0bp to feature; MODIFIER silent_mutation Average:81.022; most accessible tissue: Minghui63 flag leaf, score: 91.823 N N N N
vg0105761092 T -> C LOC_Os01g10790.1 intron_variant ; MODIFIER silent_mutation Average:81.022; most accessible tissue: Minghui63 flag leaf, score: 91.823 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0105761092 T C -0.01 -0.01 -0.01 -0.02 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0105761092 NA 1.40E-06 mr1272 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105761092 NA 6.29E-08 mr1024_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105761092 NA 2.08E-07 mr1045_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105761092 NA 4.23E-06 mr1053_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105761092 NA 5.58E-06 mr1127_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105761092 NA 1.89E-07 mr1159_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105761092 NA 6.96E-07 mr1232_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105761092 NA 7.92E-08 mr1248_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105761092 NA 2.19E-06 mr1250_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105761092 NA 4.04E-07 mr1250_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105761092 NA 5.16E-06 mr1296_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105761092 NA 9.07E-09 mr1299_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105761092 2.10E-06 3.02E-07 mr1408_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105761092 1.05E-06 1.05E-06 mr1412_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105761092 NA 4.01E-07 mr1466_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105761092 NA 3.27E-06 mr1467_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105761092 NA 5.83E-08 mr1482_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105761092 NA 7.86E-06 mr1497_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105761092 NA 9.51E-06 mr1556_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105761092 NA 3.34E-12 mr1565_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105761092 NA 9.33E-06 mr1611_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105761092 NA 9.01E-10 mr1612_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105761092 NA 4.65E-06 mr1617_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105761092 NA 7.58E-09 mr1624_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105761092 NA 4.77E-08 mr1700_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105761092 6.40E-06 1.21E-08 mr1727_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105761092 NA 1.49E-11 mr1739_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105761092 NA 4.22E-07 mr1747_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105761092 NA 1.63E-07 mr1748_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105761092 4.23E-06 4.24E-06 mr1753_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105761092 NA 8.59E-06 mr1756_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105761092 NA 6.48E-10 mr1759_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105761092 NA 5.79E-09 mr1763_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105761092 NA 3.11E-06 mr1767_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105761092 NA 2.87E-07 mr1785_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105761092 NA 4.55E-06 mr1811_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105761092 NA 3.33E-06 mr1814_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105761092 NA 2.94E-06 mr1823_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105761092 NA 1.04E-06 mr1831_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105761092 NA 2.42E-08 mr1840_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105761092 NA 2.01E-07 mr1856_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105761092 NA 1.48E-06 mr1876_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105761092 NA 5.67E-07 mr1880_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105761092 NA 5.28E-06 mr1894_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251