Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0105758841:

Variant ID: vg0105758841 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 5758841
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.79, T: 0.22, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:


CGGAGGCTCTACTGCATTTATATATGGGCACGGGATTACTGCAGATGAATCGAGGATGCTTGAAAGTTCAGCAAGGGGAGGAGGATGATTGCAAATTGAC[T/C]
GGATCTGTGAGCCCTATAGTTCAGCCAAGAGTGGGGGAAGAGAGCGACGAGATCTGCAAGCCTGATTCTTTGGCGAAGAGTGGAGGAGGAGGACGAAATT

Reverse complement sequence

AATTTCGTCCTCCTCCTCCACTCTTCGCCAAAGAATCAGGCTTGCAGATCTCGTCGCTCTCTTCCCCCACTCTTGGCTGAACTATAGGGCTCACAGATCC[A/G]
GTCAATTTGCAATCATCCTCCTCCCCTTGCTGAACTTTCAAGCATCCTCGATTCATCTGCAGTAATCCCGTGCCCATATATAAATGCAGTAGAGCCTCCG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 70.40% 6.60% 5.59% 17.41% NA
All Indica  2759 61.80% 6.30% 9.10% 22.76% NA
All Japonica  1512 80.30% 8.50% 0.66% 10.58% NA
Aus  269 89.20% 0.00% 0.00% 10.78% NA
Indica I  595 17.10% 0.00% 26.39% 56.47% NA
Indica II  465 84.10% 8.80% 2.58% 4.52% NA
Indica III  913 78.10% 10.70% 2.74% 8.43% NA
Indica Intermediate  786 63.50% 4.60% 7.25% 24.68% NA
Temperate Japonica  767 96.10% 2.70% 0.00% 1.17% NA
Tropical Japonica  504 71.60% 5.20% 1.59% 21.63% NA
Japonica Intermediate  241 48.10% 33.60% 0.83% 17.43% NA
VI/Aromatic  96 96.90% 0.00% 1.04% 2.08% NA
Intermediate  90 82.20% 11.10% 2.22% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0105758841 T -> DEL N N silent_mutation Average:26.453; most accessible tissue: Minghui63 panicle, score: 64.459 N N N N
vg0105758841 T -> C LOC_Os01g10770.1 upstream_gene_variant ; 234.0bp to feature; MODIFIER silent_mutation Average:26.453; most accessible tissue: Minghui63 panicle, score: 64.459 N N N N
vg0105758841 T -> C LOC_Os01g10790.1 upstream_gene_variant ; 1640.0bp to feature; MODIFIER silent_mutation Average:26.453; most accessible tissue: Minghui63 panicle, score: 64.459 N N N N
vg0105758841 T -> C LOC_Os01g10780.1 downstream_gene_variant ; 977.0bp to feature; MODIFIER silent_mutation Average:26.453; most accessible tissue: Minghui63 panicle, score: 64.459 N N N N
vg0105758841 T -> C LOC_Os01g10770-LOC_Os01g10780 intergenic_region ; MODIFIER silent_mutation Average:26.453; most accessible tissue: Minghui63 panicle, score: 64.459 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0105758841 NA 2.01E-06 mr1180 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105758841 NA 8.72E-07 mr1272 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105758841 NA 1.13E-06 mr1024_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105758841 NA 9.29E-07 mr1045_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105758841 NA 1.37E-07 mr1159_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105758841 NA 6.47E-07 mr1169_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105758841 NA 9.51E-06 mr1169_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105758841 NA 3.56E-07 mr1174_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105758841 NA 1.72E-07 mr1180_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105758841 NA 3.63E-07 mr1183_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105758841 NA 1.17E-07 mr1232_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105758841 NA 3.73E-09 mr1299_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105758841 1.94E-06 1.94E-06 mr1412_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105758841 NA 1.83E-06 mr1466_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105758841 NA 6.96E-06 mr1467_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105758841 NA 7.14E-06 mr1494_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105758841 NA 2.09E-06 mr1497_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105758841 NA 3.71E-06 mr1556_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105758841 NA 2.74E-06 mr1558_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105758841 NA 2.00E-11 mr1565_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105758841 NA 5.26E-06 mr1611_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105758841 NA 1.02E-09 mr1612_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105758841 NA 5.28E-08 mr1700_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105758841 6.03E-06 1.05E-08 mr1727_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105758841 NA 2.85E-10 mr1739_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105758841 NA 1.02E-06 mr1747_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105758841 NA 1.51E-07 mr1748_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105758841 NA 4.72E-09 mr1759_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105758841 NA 1.15E-07 mr1763_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105758841 NA 2.61E-06 mr1785_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105758841 NA 6.77E-07 mr1814_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105758841 NA 1.90E-06 mr1823_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105758841 NA 6.31E-09 mr1829_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105758841 NA 3.97E-09 mr1829_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105758841 NA 5.33E-06 mr1831_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105758841 NA 1.08E-07 mr1840_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105758841 NA 1.72E-07 mr1856_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105758841 NA 4.90E-07 mr1880_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105758841 NA 5.87E-06 mr1894_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105758841 NA 1.39E-14 mr1902_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105758841 NA 3.03E-09 mr1902_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105758841 NA 7.00E-06 mr1923_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105758841 3.57E-06 3.58E-06 mr1985_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251