\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0105757117:

Variant ID: vg0105757117 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 5757117
Reference Allele: TAlternative Allele: G
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.70, G: 0.29, others allele: 0.00, population size: 177. )

Flanking Sequence (100 bp) in Reference Genome:


CCAGCTAGCCTAGCTGGGTAAGGGCAAGCCAACTCGTTGCCAGCTTGCCAGGCTCGCCATATACCCTTTGTTTGATTGGTGTGCTTTCTATGGCAAGAAT[T/G]
AGTGGCTAGCCGTTTGGTTGCTTCAACGAATCATCTTGCTCTTTAGAGTATTTTGTGCCGCTTCTTTTCATATTGAGCAAAATAATATTGCACACAGATC

Reverse complement sequence

GATCTGTGTGCAATATTATTTTGCTCAATATGAAAAGAAGCGGCACAAAATACTCTAAAGAGCAAGATGATTCGTTGAAGCAACCAAACGGCTAGCCACT[A/C]
ATTCTTGCCATAGAAAGCACACCAATCAAACAAAGGGTATATGGCGAGCCTGGCAAGCTGGCAACGAGTTGGCTTGCCCTTACCCAGCTAGGCTAGCTGG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 78.10% 12.60% 5.69% 3.64% NA
All Indica  2759 81.70% 7.40% 8.30% 2.57% NA
All Japonica  1512 82.30% 8.70% 2.38% 6.55% NA
Aus  269 14.90% 85.10% 0.00% 0.00% NA
Indica I  595 62.20% 0.00% 27.73% 10.08% NA
Indica II  465 77.80% 21.30% 0.86% 0.00% NA
Indica III  913 95.80% 3.80% 0.22% 0.11% NA
Indica Intermediate  786 82.30% 9.00% 7.38% 1.27% NA
Temperate Japonica  767 96.10% 2.90% 0.00% 1.04% NA
Tropical Japonica  504 76.80% 5.40% 5.95% 11.90% NA
Japonica Intermediate  241 50.20% 34.40% 2.49% 12.86% NA
VI/Aromatic  96 82.30% 15.60% 2.08% 0.00% NA
Intermediate  90 81.10% 14.40% 2.22% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0105757117 T -> G LOC_Os01g10790.1 upstream_gene_variant ; 3364.0bp to feature; MODIFIER silent_mutation Average:40.125; most accessible tissue: Zhenshan97 root, score: 58.674 N N N N
vg0105757117 T -> G LOC_Os01g10770.1 downstream_gene_variant ; 374.0bp to feature; MODIFIER silent_mutation Average:40.125; most accessible tissue: Zhenshan97 root, score: 58.674 N N N N
vg0105757117 T -> G LOC_Os01g10780.1 downstream_gene_variant ; 2701.0bp to feature; MODIFIER silent_mutation Average:40.125; most accessible tissue: Zhenshan97 root, score: 58.674 N N N N
vg0105757117 T -> G LOC_Os01g10760-LOC_Os01g10770 intergenic_region ; MODIFIER silent_mutation Average:40.125; most accessible tissue: Zhenshan97 root, score: 58.674 N N N N
vg0105757117 T -> DEL N N silent_mutation Average:40.125; most accessible tissue: Zhenshan97 root, score: 58.674 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0105757117 NA 3.85E-06 mr1088 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105757117 NA 3.30E-06 mr1236 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105757117 NA 1.28E-06 mr1310 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105757117 5.79E-06 NA mr1498 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105757117 4.62E-15 1.16E-29 mr1498 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105757117 NA 1.99E-06 mr1679 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105757117 NA 4.94E-08 mr1691 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105757117 NA 1.17E-07 mr1693 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105757117 3.59E-11 NA mr1769 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105757117 9.42E-17 2.04E-33 mr1769 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105757117 6.20E-06 NA mr1925 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105757117 6.11E-09 2.58E-14 mr1925 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105757117 1.15E-09 NA mr1951 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105757117 5.78E-15 9.18E-25 mr1951 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105757117 NA 5.74E-06 mr1968 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105757117 NA 5.59E-06 mr1123_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105757117 NA 3.25E-06 mr1188_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105757117 NA 4.61E-06 mr1240_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105757117 NA 1.78E-11 mr1310_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105757117 NA 6.16E-06 mr1496_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105757117 1.52E-06 1.88E-07 mr1498_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105757117 1.94E-09 1.41E-21 mr1498_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105757117 3.95E-10 9.79E-11 mr1769_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105757117 7.67E-13 5.01E-31 mr1769_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105757117 5.41E-06 5.50E-07 mr1916_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105757117 7.91E-08 1.20E-12 mr1925_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105757117 6.87E-06 NA mr1951_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105757117 8.16E-08 1.36E-16 mr1951_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251