\
| Variant ID: vg0105757117 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 5757117 |
| Reference Allele: T | Alternative Allele: G |
| Primary Allele: T | Secondary Allele: G |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.70, G: 0.29, others allele: 0.00, population size: 177. )
CCAGCTAGCCTAGCTGGGTAAGGGCAAGCCAACTCGTTGCCAGCTTGCCAGGCTCGCCATATACCCTTTGTTTGATTGGTGTGCTTTCTATGGCAAGAAT[T/G]
AGTGGCTAGCCGTTTGGTTGCTTCAACGAATCATCTTGCTCTTTAGAGTATTTTGTGCCGCTTCTTTTCATATTGAGCAAAATAATATTGCACACAGATC
GATCTGTGTGCAATATTATTTTGCTCAATATGAAAAGAAGCGGCACAAAATACTCTAAAGAGCAAGATGATTCGTTGAAGCAACCAAACGGCTAGCCACT[A/C]
ATTCTTGCCATAGAAAGCACACCAATCAAACAAAGGGTATATGGCGAGCCTGGCAAGCTGGCAACGAGTTGGCTTGCCCTTACCCAGCTAGGCTAGCTGG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 78.10% | 12.60% | 5.69% | 3.64% | NA |
| All Indica | 2759 | 81.70% | 7.40% | 8.30% | 2.57% | NA |
| All Japonica | 1512 | 82.30% | 8.70% | 2.38% | 6.55% | NA |
| Aus | 269 | 14.90% | 85.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 62.20% | 0.00% | 27.73% | 10.08% | NA |
| Indica II | 465 | 77.80% | 21.30% | 0.86% | 0.00% | NA |
| Indica III | 913 | 95.80% | 3.80% | 0.22% | 0.11% | NA |
| Indica Intermediate | 786 | 82.30% | 9.00% | 7.38% | 1.27% | NA |
| Temperate Japonica | 767 | 96.10% | 2.90% | 0.00% | 1.04% | NA |
| Tropical Japonica | 504 | 76.80% | 5.40% | 5.95% | 11.90% | NA |
| Japonica Intermediate | 241 | 50.20% | 34.40% | 2.49% | 12.86% | NA |
| VI/Aromatic | 96 | 82.30% | 15.60% | 2.08% | 0.00% | NA |
| Intermediate | 90 | 81.10% | 14.40% | 2.22% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0105757117 | T -> G | LOC_Os01g10790.1 | upstream_gene_variant ; 3364.0bp to feature; MODIFIER | silent_mutation | Average:40.125; most accessible tissue: Zhenshan97 root, score: 58.674 | N | N | N | N |
| vg0105757117 | T -> G | LOC_Os01g10770.1 | downstream_gene_variant ; 374.0bp to feature; MODIFIER | silent_mutation | Average:40.125; most accessible tissue: Zhenshan97 root, score: 58.674 | N | N | N | N |
| vg0105757117 | T -> G | LOC_Os01g10780.1 | downstream_gene_variant ; 2701.0bp to feature; MODIFIER | silent_mutation | Average:40.125; most accessible tissue: Zhenshan97 root, score: 58.674 | N | N | N | N |
| vg0105757117 | T -> G | LOC_Os01g10760-LOC_Os01g10770 | intergenic_region ; MODIFIER | silent_mutation | Average:40.125; most accessible tissue: Zhenshan97 root, score: 58.674 | N | N | N | N |
| vg0105757117 | T -> DEL | N | N | silent_mutation | Average:40.125; most accessible tissue: Zhenshan97 root, score: 58.674 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0105757117 | NA | 3.85E-06 | mr1088 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105757117 | NA | 3.30E-06 | mr1236 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105757117 | NA | 1.28E-06 | mr1310 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105757117 | 5.79E-06 | NA | mr1498 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105757117 | 4.62E-15 | 1.16E-29 | mr1498 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105757117 | NA | 1.99E-06 | mr1679 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105757117 | NA | 4.94E-08 | mr1691 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105757117 | NA | 1.17E-07 | mr1693 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105757117 | 3.59E-11 | NA | mr1769 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105757117 | 9.42E-17 | 2.04E-33 | mr1769 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105757117 | 6.20E-06 | NA | mr1925 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105757117 | 6.11E-09 | 2.58E-14 | mr1925 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105757117 | 1.15E-09 | NA | mr1951 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105757117 | 5.78E-15 | 9.18E-25 | mr1951 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105757117 | NA | 5.74E-06 | mr1968 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105757117 | NA | 5.59E-06 | mr1123_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105757117 | NA | 3.25E-06 | mr1188_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105757117 | NA | 4.61E-06 | mr1240_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105757117 | NA | 1.78E-11 | mr1310_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105757117 | NA | 6.16E-06 | mr1496_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105757117 | 1.52E-06 | 1.88E-07 | mr1498_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105757117 | 1.94E-09 | 1.41E-21 | mr1498_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105757117 | 3.95E-10 | 9.79E-11 | mr1769_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105757117 | 7.67E-13 | 5.01E-31 | mr1769_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105757117 | 5.41E-06 | 5.50E-07 | mr1916_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105757117 | 7.91E-08 | 1.20E-12 | mr1925_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105757117 | 6.87E-06 | NA | mr1951_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105757117 | 8.16E-08 | 1.36E-16 | mr1951_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |