\
| Variant ID: vg0105753465 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 5753465 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 259. )
CTAGATATTATGTTTCTTTTCATACTTAGTGCTGCATCAGTTAAGTTTGATCTACTAAGTCGTGCTTAGAACCATAATCTCTAGCCTGCTTCTTGATTGC[C/T]
AATAAGGGTTTCATCGGGGTTTCAGCCGGTGAGTTATCTGGACGTTGCATCTGCTCATAAGGATTGCATATACATATAAGTTGGATTAGCCGATGACAAC
GTTGTCATCGGCTAATCCAACTTATATGTATATGCAATCCTTATGAGCAGATGCAACGTCCAGATAACTCACCGGCTGAAACCCCGATGAAACCCTTATT[G/A]
GCAATCAAGAAGCAGGCTAGAGATTATGGTTCTAAGCACGACTTAGTAGATCAAACTTAACTGATGCAGCACTAAGTATGAAAAGAAACATAATATCTAG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 85.30% | 9.60% | 4.87% | 0.19% | NA |
| All Indica | 2759 | 85.00% | 7.20% | 7.61% | 0.11% | NA |
| All Japonica | 1512 | 98.40% | 0.30% | 0.86% | 0.40% | NA |
| Aus | 269 | 14.10% | 84.00% | 1.86% | 0.00% | NA |
| Indica I | 595 | 79.20% | 0.00% | 20.67% | 0.17% | NA |
| Indica II | 465 | 76.60% | 20.90% | 2.58% | 0.00% | NA |
| Indica III | 913 | 95.60% | 3.80% | 0.44% | 0.11% | NA |
| Indica Intermediate | 786 | 82.20% | 8.70% | 9.03% | 0.13% | NA |
| Temperate Japonica | 767 | 99.50% | 0.10% | 0.13% | 0.26% | NA |
| Tropical Japonica | 504 | 97.40% | 0.40% | 1.98% | 0.20% | NA |
| Japonica Intermediate | 241 | 97.10% | 0.80% | 0.83% | 1.24% | NA |
| VI/Aromatic | 96 | 83.30% | 15.60% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 90.00% | 8.90% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0105753465 | C -> T | LOC_Os01g10740.1 | upstream_gene_variant ; 4195.0bp to feature; MODIFIER | silent_mutation | Average:35.616; most accessible tissue: Minghui63 young leaf, score: 64.378 | N | N | N | N |
| vg0105753465 | C -> T | LOC_Os01g10760.1 | upstream_gene_variant ; 2430.0bp to feature; MODIFIER | silent_mutation | Average:35.616; most accessible tissue: Minghui63 young leaf, score: 64.378 | N | N | N | N |
| vg0105753465 | C -> T | LOC_Os01g10750.1 | downstream_gene_variant ; 3030.0bp to feature; MODIFIER | silent_mutation | Average:35.616; most accessible tissue: Minghui63 young leaf, score: 64.378 | N | N | N | N |
| vg0105753465 | C -> T | LOC_Os01g10770.1 | downstream_gene_variant ; 4026.0bp to feature; MODIFIER | silent_mutation | Average:35.616; most accessible tissue: Minghui63 young leaf, score: 64.378 | N | N | N | N |
| vg0105753465 | C -> T | LOC_Os01g10760-LOC_Os01g10770 | intergenic_region ; MODIFIER | silent_mutation | Average:35.616; most accessible tissue: Minghui63 young leaf, score: 64.378 | N | N | N | N |
| vg0105753465 | C -> DEL | N | N | silent_mutation | Average:35.616; most accessible tissue: Minghui63 young leaf, score: 64.378 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0105753465 | NA | 1.20E-10 | mr1769 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105753465 | NA | 4.29E-08 | mr1951 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105753465 | 3.21E-06 | NA | mr1110_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |