\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0105753465:

Variant ID: vg0105753465 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 5753465
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:


CTAGATATTATGTTTCTTTTCATACTTAGTGCTGCATCAGTTAAGTTTGATCTACTAAGTCGTGCTTAGAACCATAATCTCTAGCCTGCTTCTTGATTGC[C/T]
AATAAGGGTTTCATCGGGGTTTCAGCCGGTGAGTTATCTGGACGTTGCATCTGCTCATAAGGATTGCATATACATATAAGTTGGATTAGCCGATGACAAC

Reverse complement sequence

GTTGTCATCGGCTAATCCAACTTATATGTATATGCAATCCTTATGAGCAGATGCAACGTCCAGATAACTCACCGGCTGAAACCCCGATGAAACCCTTATT[G/A]
GCAATCAAGAAGCAGGCTAGAGATTATGGTTCTAAGCACGACTTAGTAGATCAAACTTAACTGATGCAGCACTAAGTATGAAAAGAAACATAATATCTAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.30% 9.60% 4.87% 0.19% NA
All Indica  2759 85.00% 7.20% 7.61% 0.11% NA
All Japonica  1512 98.40% 0.30% 0.86% 0.40% NA
Aus  269 14.10% 84.00% 1.86% 0.00% NA
Indica I  595 79.20% 0.00% 20.67% 0.17% NA
Indica II  465 76.60% 20.90% 2.58% 0.00% NA
Indica III  913 95.60% 3.80% 0.44% 0.11% NA
Indica Intermediate  786 82.20% 8.70% 9.03% 0.13% NA
Temperate Japonica  767 99.50% 0.10% 0.13% 0.26% NA
Tropical Japonica  504 97.40% 0.40% 1.98% 0.20% NA
Japonica Intermediate  241 97.10% 0.80% 0.83% 1.24% NA
VI/Aromatic  96 83.30% 15.60% 1.04% 0.00% NA
Intermediate  90 90.00% 8.90% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0105753465 C -> T LOC_Os01g10740.1 upstream_gene_variant ; 4195.0bp to feature; MODIFIER silent_mutation Average:35.616; most accessible tissue: Minghui63 young leaf, score: 64.378 N N N N
vg0105753465 C -> T LOC_Os01g10760.1 upstream_gene_variant ; 2430.0bp to feature; MODIFIER silent_mutation Average:35.616; most accessible tissue: Minghui63 young leaf, score: 64.378 N N N N
vg0105753465 C -> T LOC_Os01g10750.1 downstream_gene_variant ; 3030.0bp to feature; MODIFIER silent_mutation Average:35.616; most accessible tissue: Minghui63 young leaf, score: 64.378 N N N N
vg0105753465 C -> T LOC_Os01g10770.1 downstream_gene_variant ; 4026.0bp to feature; MODIFIER silent_mutation Average:35.616; most accessible tissue: Minghui63 young leaf, score: 64.378 N N N N
vg0105753465 C -> T LOC_Os01g10760-LOC_Os01g10770 intergenic_region ; MODIFIER silent_mutation Average:35.616; most accessible tissue: Minghui63 young leaf, score: 64.378 N N N N
vg0105753465 C -> DEL N N silent_mutation Average:35.616; most accessible tissue: Minghui63 young leaf, score: 64.378 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0105753465 NA 1.20E-10 mr1769 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105753465 NA 4.29E-08 mr1951 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105753465 3.21E-06 NA mr1110_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251