\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0105752914:

Variant ID: vg0105752914 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 5752914
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 227. )

Flanking Sequence (100 bp) in Reference Genome:


AGTTTCCTTTTATCTTTAGGAAAGTGTGTTTAGTGTCCTATAAGGACTTTATCTTTTTCTTTTATCTATAGGAAAGTTTCTTTCTTGTCCAACAAGGACT[T/A]
GTATCAACCCATGGGTATAAATATGTACACCCGGGGTCTATGTAATTAATCTCATGATCAATACAATTCGGCGCATCGCCACCTTTTACCTTTTCTACTT

Reverse complement sequence

AAGTAGAAAAGGTAAAAGGTGGCGATGCGCCGAATTGTATTGATCATGAGATTAATTACATAGACCCCGGGTGTACATATTTATACCCATGGGTTGATAC[A/T]
AGTCCTTGTTGGACAAGAAAGAAACTTTCCTATAGATAAAAGAAAAAGATAAAGTCCTTATAGGACACTAAACACACTTTCCTAAAGATAAAAGGAAACT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 75.40% 8.40% 7.17% 9.06% NA
All Indica  2759 66.50% 11.00% 10.47% 12.07% NA
All Japonica  1512 87.00% 5.60% 2.78% 4.63% NA
Aus  269 89.20% 0.70% 2.23% 7.81% NA
Indica I  595 15.30% 35.60% 23.36% 25.71% NA
Indica II  465 92.00% 0.90% 3.01% 4.09% NA
Indica III  913 87.70% 2.30% 6.02% 3.94% NA
Indica Intermediate  786 65.40% 8.40% 10.31% 15.90% NA
Temperate Japonica  767 98.60% 0.70% 0.26% 0.52% NA
Tropical Japonica  504 71.60% 14.10% 5.56% 8.73% NA
Japonica Intermediate  241 82.20% 3.70% 4.98% 9.13% NA
VI/Aromatic  96 96.90% 1.00% 1.04% 1.04% NA
Intermediate  90 90.00% 5.60% 1.11% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0105752914 T -> A LOC_Os01g10740.1 upstream_gene_variant ; 3644.0bp to feature; MODIFIER silent_mutation Average:29.154; most accessible tissue: Minghui63 young leaf, score: 56.213 N N N N
vg0105752914 T -> A LOC_Os01g10760.1 upstream_gene_variant ; 1879.0bp to feature; MODIFIER silent_mutation Average:29.154; most accessible tissue: Minghui63 young leaf, score: 56.213 N N N N
vg0105752914 T -> A LOC_Os01g10750.1 downstream_gene_variant ; 2479.0bp to feature; MODIFIER silent_mutation Average:29.154; most accessible tissue: Minghui63 young leaf, score: 56.213 N N N N
vg0105752914 T -> A LOC_Os01g10770.1 downstream_gene_variant ; 4577.0bp to feature; MODIFIER silent_mutation Average:29.154; most accessible tissue: Minghui63 young leaf, score: 56.213 N N N N
vg0105752914 T -> A LOC_Os01g10760-LOC_Os01g10770 intergenic_region ; MODIFIER silent_mutation Average:29.154; most accessible tissue: Minghui63 young leaf, score: 56.213 N N N N
vg0105752914 T -> DEL N N silent_mutation Average:29.154; most accessible tissue: Minghui63 young leaf, score: 56.213 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0105752914 2.89E-06 1.27E-06 mr1160_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251