\
| Variant ID: vg0105709551 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 5709551 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CTCGATATTACGATCTATTTAGAGTATATTTTAAGAATCAGCTGATGAGTTCGGAGAAGATAGGGAAATCAGATTCTGACTTCTAATTTATTTTCTAAAT[G/A]
TTATAACTATATTTTTTTAAAATCTAAATGCAAAGCAAAAATGTTTGTGAAAAGATCTGATTATAAAAGAAGATGCAACCGCTAGAAGCTTCCTTTAACC
GGTTAAAGGAAGCTTCTAGCGGTTGCATCTTCTTTTATAATCAGATCTTTTCACAAACATTTTTGCTTTGCATTTAGATTTTAAAAAAATATAGTTATAA[C/T]
ATTTAGAAAATAAATTAGAAGTCAGAATCTGATTTCCCTATCTTCTCCGAACTCATCAGCTGATTCTTAAAATATACTCTAAATAGATCGTAATATCGAG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 90.90% | 8.70% | 0.38% | 0.00% | NA |
| All Indica | 2759 | 95.40% | 4.40% | 0.14% | 0.00% | NA |
| All Japonica | 1512 | 81.30% | 17.90% | 0.73% | 0.00% | NA |
| Aus | 269 | 96.30% | 3.30% | 0.37% | 0.00% | NA |
| Indica I | 595 | 94.30% | 5.70% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 97.70% | 2.30% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 91.30% | 8.10% | 0.51% | 0.00% | NA |
| Temperate Japonica | 767 | 99.20% | 0.70% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 48.00% | 50.40% | 1.59% | 0.00% | NA |
| Japonica Intermediate | 241 | 94.20% | 5.00% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 87.80% | 10.00% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0105709551 | G -> A | LOC_Os01g10680.1 | upstream_gene_variant ; 1793.0bp to feature; MODIFIER | silent_mutation | Average:66.035; most accessible tissue: Callus, score: 96.449 | N | N | N | N |
| vg0105709551 | G -> A | LOC_Os01g10680-LOC_Os01g10690 | intergenic_region ; MODIFIER | silent_mutation | Average:66.035; most accessible tissue: Callus, score: 96.449 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0105709551 | 3.02E-07 | 3.50E-07 | mr1498 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105709551 | NA | 1.72E-06 | mr1925 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105709551 | NA | 2.07E-07 | mr1925 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105709551 | NA | 4.72E-06 | mr1083_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105709551 | 8.02E-06 | 2.78E-07 | mr1498_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105709551 | NA | 4.07E-07 | mr1498_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105709551 | 4.46E-07 | NA | mr1925_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |