\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0105709551:

Variant ID: vg0105709551 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 5709551
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTCGATATTACGATCTATTTAGAGTATATTTTAAGAATCAGCTGATGAGTTCGGAGAAGATAGGGAAATCAGATTCTGACTTCTAATTTATTTTCTAAAT[G/A]
TTATAACTATATTTTTTTAAAATCTAAATGCAAAGCAAAAATGTTTGTGAAAAGATCTGATTATAAAAGAAGATGCAACCGCTAGAAGCTTCCTTTAACC

Reverse complement sequence

GGTTAAAGGAAGCTTCTAGCGGTTGCATCTTCTTTTATAATCAGATCTTTTCACAAACATTTTTGCTTTGCATTTAGATTTTAAAAAAATATAGTTATAA[C/T]
ATTTAGAAAATAAATTAGAAGTCAGAATCTGATTTCCCTATCTTCTCCGAACTCATCAGCTGATTCTTAAAATATACTCTAAATAGATCGTAATATCGAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.90% 8.70% 0.38% 0.00% NA
All Indica  2759 95.40% 4.40% 0.14% 0.00% NA
All Japonica  1512 81.30% 17.90% 0.73% 0.00% NA
Aus  269 96.30% 3.30% 0.37% 0.00% NA
Indica I  595 94.30% 5.70% 0.00% 0.00% NA
Indica II  465 99.40% 0.60% 0.00% 0.00% NA
Indica III  913 97.70% 2.30% 0.00% 0.00% NA
Indica Intermediate  786 91.30% 8.10% 0.51% 0.00% NA
Temperate Japonica  767 99.20% 0.70% 0.13% 0.00% NA
Tropical Japonica  504 48.00% 50.40% 1.59% 0.00% NA
Japonica Intermediate  241 94.20% 5.00% 0.83% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 87.80% 10.00% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0105709551 G -> A LOC_Os01g10680.1 upstream_gene_variant ; 1793.0bp to feature; MODIFIER silent_mutation Average:66.035; most accessible tissue: Callus, score: 96.449 N N N N
vg0105709551 G -> A LOC_Os01g10680-LOC_Os01g10690 intergenic_region ; MODIFIER silent_mutation Average:66.035; most accessible tissue: Callus, score: 96.449 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0105709551 3.02E-07 3.50E-07 mr1498 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105709551 NA 1.72E-06 mr1925 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105709551 NA 2.07E-07 mr1925 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105709551 NA 4.72E-06 mr1083_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105709551 8.02E-06 2.78E-07 mr1498_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105709551 NA 4.07E-07 mr1498_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105709551 4.46E-07 NA mr1925_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251