\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0105650370:

Variant ID: vg0105650370 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 5650370
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 128. )

Flanking Sequence (100 bp) in Reference Genome:


TGTATGTGTTCTTAGCGACTTATAATATTGAAAAAAAACTACATTGAAAACATCAAAATCAACTTTAAAACCAGGGAAAACCATGAGGCCCTAAGGCATT[C/T]
GATCGAGCAGAGGAATTTTGTGAAAATTCACTAAAATTGGACTGGTTCTCGTGAAAGTTCTATAAAATTGCTATTGTTTAAAGGAATATTGGCTCAGGCT

Reverse complement sequence

AGCCTGAGCCAATATTCCTTTAAACAATAGCAATTTTATAGAACTTTCACGAGAACCAGTCCAATTTTAGTGAATTTTCACAAAATTCCTCTGCTCGATC[G/A]
AATGCCTTAGGGCCTCATGGTTTTCCCTGGTTTTAAAGTTGATTTTGATGTTTTCAATGTAGTTTTTTTTCAATATTATAAGTCGCTAAGAACACATACA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.90% 9.90% 0.19% 0.00% NA
All Indica  2759 83.10% 16.70% 0.22% 0.00% NA
All Japonica  1512 99.80% 0.10% 0.13% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 59.50% 39.70% 0.84% 0.00% NA
Indica II  465 79.60% 20.40% 0.00% 0.00% NA
Indica III  913 98.00% 2.00% 0.00% 0.00% NA
Indica Intermediate  786 85.80% 14.10% 0.13% 0.00% NA
Temperate Japonica  767 99.90% 0.00% 0.13% 0.00% NA
Tropical Japonica  504 99.60% 0.20% 0.20% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 94.40% 4.40% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0105650370 C -> T LOC_Os01g10590.1 upstream_gene_variant ; 2223.0bp to feature; MODIFIER silent_mutation Average:27.462; most accessible tissue: Callus, score: 47.326 N N N N
vg0105650370 C -> T LOC_Os01g10580-LOC_Os01g10590 intergenic_region ; MODIFIER silent_mutation Average:27.462; most accessible tissue: Callus, score: 47.326 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0105650370 1.41E-08 2.32E-10 mr1498 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105650370 6.47E-09 5.62E-15 mr1498 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105650370 NA 1.59E-09 mr1769 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105650370 3.98E-06 NA mr1769 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105650370 NA 4.79E-13 mr1925 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105650370 NA 1.38E-11 mr1925 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105650370 2.32E-07 1.28E-10 mr1951 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105650370 1.95E-07 3.30E-11 mr1951 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105650370 3.66E-08 5.29E-18 mr1498_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105650370 1.97E-06 4.36E-13 mr1498_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105650370 2.35E-06 6.58E-12 mr1769_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105650370 5.36E-06 3.12E-10 mr1769_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105650370 2.24E-06 1.97E-14 mr1925_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105650370 NA 1.27E-11 mr1925_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105650370 6.37E-06 9.49E-10 mr1951_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105650370 NA 8.68E-11 mr1951_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251