\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0105636088:

Variant ID: vg0105636088 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 5636088
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, A: 0.05, others allele: 0.00, population size: 115. )

Flanking Sequence (100 bp) in Reference Genome:


TGCACAATAGCTTATTAGCGGACTCTCTCCGTTGCCACATAAACAAATTAATTTAATAATATCAAAGAGAGGAGAAAAGAAGAACATCATGGCTACCTAT[A/G]
ACATCAGCTTACAGTCGACTCTTAGTATATTTATTAAAAAAAATTAATTATATGGAGATGAAGAAAAGGAAAGAAGAGTAATAAAAAATATTATGGTGCA

Reverse complement sequence

TGCACCATAATATTTTTTATTACTCTTCTTTCCTTTTCTTCATCTCCATATAATTAATTTTTTTTAATAAATATACTAAGAGTCGACTGTAAGCTGATGT[T/C]
ATAGGTAGCCATGATGTTCTTCTTTTCTCCTCTCTTTGATATTATTAAATTAATTTGTTTATGTGGCAACGGAGAGAGTCCGCTAATAAGCTATTGTGCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.90% 43.70% 0.17% 0.28% NA
All Indica  2759 78.80% 21.10% 0.14% 0.00% NA
All Japonica  1512 10.30% 89.60% 0.13% 0.00% NA
Aus  269 93.30% 6.30% 0.37% 0.00% NA
Indica I  595 55.00% 44.70% 0.34% 0.00% NA
Indica II  465 77.20% 22.80% 0.00% 0.00% NA
Indica III  913 96.80% 3.20% 0.00% 0.00% NA
Indica Intermediate  786 76.80% 22.90% 0.25% 0.00% NA
Temperate Japonica  767 2.30% 97.70% 0.00% 0.00% NA
Tropical Japonica  504 19.80% 79.80% 0.40% 0.00% NA
Japonica Intermediate  241 15.80% 84.20% 0.00% 0.00% NA
VI/Aromatic  96 10.40% 77.10% 0.00% 12.50% NA
Intermediate  90 54.40% 43.30% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0105636088 A -> G LOC_Os01g10580.1 upstream_gene_variant ; 3681.0bp to feature; MODIFIER silent_mutation Average:42.523; most accessible tissue: Zhenshan97 panicle, score: 61.671 N N N N
vg0105636088 A -> G LOC_Os01g10560-LOC_Os01g10580 intergenic_region ; MODIFIER silent_mutation Average:42.523; most accessible tissue: Zhenshan97 panicle, score: 61.671 N N N N
vg0105636088 A -> DEL N N silent_mutation Average:42.523; most accessible tissue: Zhenshan97 panicle, score: 61.671 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0105636088 2.65E-12 5.66E-18 mr1498 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105636088 1.74E-10 8.72E-20 mr1498 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105636088 5.50E-08 1.55E-12 mr1769 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105636088 NA 1.76E-06 mr1795 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105636088 NA 4.79E-06 mr1881 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105636088 1.98E-07 1.43E-06 mr1925 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105636088 4.36E-06 4.29E-14 mr1925 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105636088 NA 1.23E-07 mr1951 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105636088 5.99E-08 1.47E-13 mr1951 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105636088 NA 7.83E-06 mr1236_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105636088 1.01E-09 2.27E-07 mr1498_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105636088 6.65E-09 2.06E-18 mr1498_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105636088 1.58E-07 1.66E-15 mr1769_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105636088 NA 8.04E-06 mr1795_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105636088 4.85E-10 1.04E-06 mr1925_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105636088 9.44E-07 1.18E-14 mr1925_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105636088 NA 1.91E-07 mr1951_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105636088 NA 1.29E-12 mr1951_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105636088 NA 2.21E-06 mr1959_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251