\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0105626001:

Variant ID: vg0105626001 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 5626001
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 123. )

Flanking Sequence (100 bp) in Reference Genome:


TCAGTTTAGGATAGCATATTAATGAATCACTTTGAAGCGATAGCATTCTAGCGAAACCATCCTTTTACGATAGTAAAATCCCAAATTTCTTCTCCTGGAC[T/A]
GACTAATTGGGCCAAATATATGCTACTTGGGCCGATGGACCATGAGACCAACTGACCAAGTTAGATCAAAGTCAACAAGACATGAATAAGTAAAATAAAA

Reverse complement sequence

TTTTATTTTACTTATTCATGTCTTGTTGACTTTGATCTAACTTGGTCAGTTGGTCTCATGGTCCATCGGCCCAAGTAGCATATATTTGGCCCAATTAGTC[A/T]
GTCCAGGAGAAGAAATTTGGGATTTTACTATCGTAAAAGGATGGTTTCGCTAGAATGCTATCGCTTCAAAGTGATTCATTAATATGCTATCCTAAACTGA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.20% 12.40% 2.12% 0.28% NA
All Indica  2759 81.20% 17.50% 1.30% 0.00% NA
All Japonica  1512 92.10% 4.10% 3.77% 0.00% NA
Aus  269 96.30% 3.30% 0.37% 0.00% NA
Indica I  595 56.50% 40.30% 3.19% 0.00% NA
Indica II  465 78.70% 20.90% 0.43% 0.00% NA
Indica III  913 97.00% 3.00% 0.00% 0.00% NA
Indica Intermediate  786 82.80% 15.30% 1.91% 0.00% NA
Temperate Japonica  767 94.80% 0.80% 4.43% 0.00% NA
Tropical Japonica  504 89.10% 9.30% 1.59% 0.00% NA
Japonica Intermediate  241 90.00% 3.70% 6.22% 0.00% NA
VI/Aromatic  96 58.30% 26.00% 3.12% 12.50% NA
Intermediate  90 87.80% 7.80% 3.33% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0105626001 T -> A LOC_Os01g10560-LOC_Os01g10580 intergenic_region ; MODIFIER silent_mutation Average:45.938; most accessible tissue: Minghui63 panicle, score: 76.913 N N N N
vg0105626001 T -> DEL N N silent_mutation Average:45.938; most accessible tissue: Minghui63 panicle, score: 76.913 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0105626001 1.85E-06 7.58E-11 mr1498 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105626001 1.74E-08 5.79E-16 mr1498 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105626001 3.83E-06 9.64E-12 mr1769 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105626001 3.85E-07 1.46E-09 mr1769 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105626001 NA 3.07E-06 mr1795 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105626001 NA 7.54E-15 mr1925 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105626001 1.47E-06 7.11E-14 mr1925 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105626001 6.78E-09 4.48E-13 mr1951 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105626001 1.41E-07 4.57E-12 mr1951 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105626001 3.01E-06 NA mr1301_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105626001 NA 2.13E-16 mr1498_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105626001 2.05E-06 1.41E-13 mr1498_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105626001 NA 3.35E-13 mr1769_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105626001 6.75E-07 4.45E-12 mr1769_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105626001 NA 1.19E-12 mr1925_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105626001 NA 4.15E-12 mr1925_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105626001 NA 8.78E-09 mr1951_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105626001 NA 9.72E-12 mr1951_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105626001 NA 3.37E-07 mr1959_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251