Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0105514748:

Variant ID: vg0105514748 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 5514748
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.94, T: 0.06, others allele: 0.00, population size: 115. )

Flanking Sequence (100 bp) in Reference Genome:


AATTCTTCAAACTTTCAACTTTTTCATCATATTAAAATTTTCCTACACACATAAACTTCCAACTTTTCCGTCACATCGTTTCAATTTCAACCAAACTTTC[C/T]
AATTTTGATGTGAACTAAACGCAGCCCCTATGTGAGAAGGTGATAAACAAATGTGAACAGTGAACATGTGCATGAACATGAATGGAAACATAGTAATTAA

Reverse complement sequence

TTAATTACTATGTTTCCATTCATGTTCATGCACATGTTCACTGTTCACATTTGTTTATCACCTTCTCACATAGGGGCTGCGTTTAGTTCACATCAAAATT[G/A]
GAAAGTTTGGTTGAAATTGAAACGATGTGACGGAAAAGTTGGAAGTTTATGTGTGTAGGAAAATTTTAATATGATGAAAAAGTTGAAAGTTTGAAGAATT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.00% 34.80% 0.17% 0.00% NA
All Indica  2759 42.80% 57.10% 0.07% 0.00% NA
All Japonica  1512 97.60% 2.20% 0.26% 0.00% NA
Aus  269 98.50% 1.50% 0.00% 0.00% NA
Indica I  595 97.10% 2.70% 0.17% 0.00% NA
Indica II  465 25.20% 74.80% 0.00% 0.00% NA
Indica III  913 9.90% 90.00% 0.11% 0.00% NA
Indica Intermediate  786 50.50% 49.50% 0.00% 0.00% NA
Temperate Japonica  767 95.70% 3.80% 0.52% 0.00% NA
Tropical Japonica  504 99.40% 0.60% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 63.30% 34.40% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0105514748 C -> T LOC_Os01g10450.1 upstream_gene_variant ; 274.0bp to feature; MODIFIER silent_mutation Average:74.79; most accessible tissue: Zhenshan97 flag leaf, score: 91.333 N N N N
vg0105514748 C -> T LOC_Os01g10450.2 upstream_gene_variant ; 268.0bp to feature; MODIFIER silent_mutation Average:74.79; most accessible tissue: Zhenshan97 flag leaf, score: 91.333 N N N N
vg0105514748 C -> T LOC_Os01g10450-LOC_Os01g10460 intergenic_region ; MODIFIER silent_mutation Average:74.79; most accessible tissue: Zhenshan97 flag leaf, score: 91.333 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0105514748 C T 0.0 0.01 0.01 0.01 0.0 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0105514748 NA 3.11E-09 mr1565 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105514748 NA 5.73E-07 mr1696 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105514748 3.47E-06 NA mr1769 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105514748 NA 8.05E-06 mr1842 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105514748 NA 7.54E-06 mr1925 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105514748 NA 1.71E-06 mr1041_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105514748 NA 1.33E-07 mr1184_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105514748 NA 7.01E-07 mr1278_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105514748 NA 3.33E-06 mr1293_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105514748 NA 6.91E-06 mr1508_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105514748 NA 4.65E-06 mr1524_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105514748 NA 9.38E-13 mr1565_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105514748 NA 8.29E-06 mr1616_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105514748 NA 3.66E-08 mr1683_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105514748 NA 5.25E-06 mr1756_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105514748 3.50E-06 3.49E-06 mr1766_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105514748 NA 1.01E-17 mr1794_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105514748 NA 1.07E-10 mr1794_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105514748 NA 4.05E-06 mr1812_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105514748 NA 4.77E-06 mr1925_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251